TRF output to .gff file

Question

[Alice]

Hello, biostars!

I'm trying to get .gff file from Tandem Repeat Finder output.

Since TRF can't do that, I've found TRAP tool, which can create .gff. But, TRAP creates as many .gff files as the number of contigs (ok, there is 'cat' command).

The main problem is lines of .gff:

.    TRF    satellite    1    72    144    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 2" "copy number = 36.0" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TA" ; color 9
.    TRF    satellite    452    512    69    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 14" "copy number = 4.7" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TTCTCCATTAATTA" ; color 9
.    TRF    satellite    453    498    74    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 23" "copy number = 2.0" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TCTCCATTAATAATTCTCCATTA" ; color 9

Instead of seq. name there are . TRF. Therefore it is impossible to sort this .gff file.

Is there any tool for obtaining 'normal' .gff file or any script to produce such a file from TRF output?

PS: RepeatMasker makes .gff files, but my aim is creating one .gff file from several tools, thus i'm going to intersect two or three .gff files.

Answer 1

[lexnederbragt]

Here is a quick python script that I use for this purpose. It uses the latest version of TRF, with the -ngs flag to get the compact output. Not very well tested yet, so use at your own risk:

[Alice]

Thank you! Very useful, I'll try it.

[yinliduo]

Excuse me, I also meet this question, I wonder where is your python code, thank you!

Answer 2

[Adam Taranto]

You can do this with the python package TRF2GFF, it takes the dat file output from trf and converts in into gff3 format.