start and stop position of mapping in Blast

Question

[navyeinstein1991]

I used makeblastdb to search many short fasta sequences in a known organism. I successfully completed this step and got the mappings. My question is

How can I get the start and stop coordinate?

for eg

Query  1        AATATAGGTGGTACCACGGAATATCCGTCCTATTTGTATATAGGATGGATAtttttattt  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1765181  AATATAGGTGGTACCACGGAATATCCGTCCTATTTGTATATAGGATGGATATTTTTATTT  1765122

Query  61       ttttAGGAGGTATAGCAAATGG  82
                ||||||||||||||||||||||
Sbjct  1765121  TTTTAGGAGGTATAGCAAATGG  1765100

How to get 1765100 and 1765181 from a text file with many mappings like this. I would also like to count the number of mappings or query sequences?

[Zhidkov]

use tabular output option:

blastn -query some.fa -db some.fa  -outfmt 6

[navyeinstein1991]

Thank You :)

[Neilfws]

Every bioinformatics journey begins with a BLAST parser :)

Answer 1

[navyeinstein1991]

blastn -query some.fa -db some.fa  -outfmt 6 | awk '{print $9 "\t" $10}'

[Zhidkov]

in case alignment of query is in opposite direction to subject, then column 9 will be greater than column 10

blastn -query query.fa -db subject.fa  -outfmt 6 | awk '{OFS="\t"; if ($9>$10) print $9,$10; else print $10,$9}'

[PoGibas]

Have in mind that sometimes $9 is greater than $10.

Also, there is no point in your answer as you're blasting some.fa against some.fa.

[Zhidkov]

there are some cases when you run blast using query both as query and as subject, clustering groups of sequences for example.