Plant miRNA prediction

Question

[swati25887]

Hi everyone

I am doing a next gen sequencing project to identify miRNA in brassica. I made the small RNA libraries and sent them for sequencing and subsequent analysis. The data that I got back shows a lot of novel miRNAs and also some novel miRNAs with similarity to already known miRNAs in miRbase. For eg. aaaacggaaucguaagcuuc is called similar to osa-miR2121a (whose sequence is aaaacggagcgguccauuagcgcg). The similarity between these two miRNAs is between 2-8nt. Same criteria is for other miRNAs.

My question is how should I interpret this data? When doing clustering of miRNAs in families which sequence should I use? I think similarity at seed region can not be used as a criteria for clustering!

I would welcome any kind of suggestions.

Thanks

Answer 1

[Saima]

By clustering miRNAs, do you mean assigning these to a specific miRNA family based on sequence identity? In case of plants, usually mature miRNAs are assigned to the same family based on perfect or near-perfect sequence matches (allowing 0-4 mismatches according to Meyers et al., 2008 paper).