How to interpate information of fastq formate read files ?

Question

[jack]

Hi,

I have read file in Fastq file format. The file format is not well understandable for me.

I looked at first few lines of that, and looks like :

@HISEQ:10:C3B24ACXX:6:2303:18849:17686 2:N:0:ACAGTG
ATCTTCACAAATAAAACAAGCAATTCAATCGATTGATGAAGTATTTGCAAAGGAGAGGAAACATAGGAGTGGAAAAAAAGATGCAGAGTTCAGAT
+
?@?D7DFDHHHFHIIIIIIIIIGGIIIIHDHCB@F9<DD94BG9?DC<<DDFHG@CHE?F;C@AGADHCEIGEE>=;BDFCDCDBB?3(5>:>ACC:>CCD
@HISEQ:10:C3B24ACXX:6:2303:18827:17745 2:N:0:ACAGTG

adinfo@wks-12-49:/MMCI/MS/DeNovoAssembly/work/mirRegression/DE/Data_Martin_lab/140718/Sample_A1$ head -6 A1_ACAGTG_L006_R2_004.fastq
@HISEQ:10:C3B24ACXX:6:2303:18849:17686 2:N:0:ACAGTG
ATCTTCACAACACATAACAAGCAATTCAATCGATTGATGAAGTAAAAGGAGAGGAAACATAGGAGATGTGGAAAAAGATGCAGAGTTCAGAT
+
?@?D7DFDHHHFHIIIIIIIIIGGIIIIHDHCB@F9<DD94BG9?DC<<DDFHG@CHE?F;C@AGADHCEIGEE>=;BDFCDCDBB?3(5>:>ACC:>CCD
@HISEQ:10:C3B24ACXX:6:2303:18827:17745 2:N:0:ACAGTG

Basically what I just understand is that, there is read sequence. what are the others means?

[smilefreak]

Basically every four lines is a new read record.

Line 1: the sequence identifier.

Line 2: The actually DNA sequence.

Line 3: Usually just a + but can contain extra information.

Line 4: The quality represented using ascii character values.

Source: http://en.wikipedia.org/wiki/FASTQ_format

Answer 1

[Devon Ryan]

Have a read through the wikipedia article. That should clarify things.

Answer 2

[Michael]

It would have been easy to google that out: "fastq" 1. hit https://en.wikipedia.org/wiki/FASTQ_format is quite correct for a start. I recommend the following work-flow for the future:

• Given you have a question about concept "ABC"
• Navigate your web-browser to a search engine of your choice (e.g. duckduckgo)
• Type "ABC" into the search field or simply the URL field of your browser (works most of the time)
• Press 'Enter'
• Profit

In short: The meaning of the other lines are quality scores.