Extraction Of Part Of Different Grp Of Nucleotide Sequence In 10000 Of Sequences.

Question

[Pawan Jayaswal]

Hi

I would like to extract particular reason in the 1000 contigs.For example I am having 10000 sequences as a contig and each sequence file having 5000 nucleotide base pair. Suppose contig one is having 1000 base pair and i want to extract 1-200 , 251-456, 500-609 and others so in this way I am having 1000 of ranges and I want to extract in all 10000 sequences. I also want to store these file in new file .

[ALchEmiXt]

Think you need to be more specific on you use case (what do you exactly want to do). The contig file is clear but what and how do you get/store the ranges? Or do you need to find these first as well by mapping of another set of sequences?

[Pawan Jayaswal]

I would like to elaborate it....

contig00001 length=24020 numreads=1501 TCCTTAAGAATGTCTTCAATACAATCTTTTTGGATTGATTTTGTCAAATCAACCAGGAAA TTTTCCATGTCTTCCAAACCTTGCTCTACAAAGATTATTTTTCCAATGAACAACATCAGC CTTGATACCCACTTCATATGATGAGATTCTGTTATCAAAATTATACTTACCTTGCAAATA TGATGTGAATTTTTTGTGTTGTGATTCACCAATCCCAGAATCCATGGATCTCAAATTTGA

and

I want to exaract 1-50, 61-250, 255-699 sequences from this file. In this way I am having 1000 file and 1000 of pattern.

Any suggestion related with it is welcome.

Answer 1

[Ido Tamir]

sounds like a job for EMBOSS extractseq

 extractseq tembl:x65921 -reg "782..856,951..1095,1557..1612,1787..1912" stdout

If you really have many regions, you can also specify a regions file with '-regions @myfile'