The nucleotides on ENST00000347310 and ENST00000425614 do not agree on the same chromosomal position (67240275)
1
0
Entering edit mode
10.5 years ago
pwg46 ▴ 540

Using my own calculations (which I have looked over many times), the 1-based chromosomal position 67240275 corresponds to a 1-based position of 1142 on ENST00000347310 and a 1-based position of 427 on ENST00000425614. Using the sequences straight from ensembl's Grch37.cds.all.fa file, I wanted to make sure that nucleotide at position 1142 on ENST00000347310 matched the nucleotide at position 427 on ENST00000425614. However, for the first transcript I get a nucleotide 'G', and for the latter I get 'C'. What could be the source of this mismatch?

position nucleotide ensembl grch38 base • 2.3k views
ADD COMMENT
3
Entering edit mode
10.5 years ago
Brice Sarver ★ 3.8k

I looked at the exon/intron sequences for both of these transcripts. One transcript has 11 exons and the other has six. The position in question falls within a 103-mer exon:

ACAACAGAGGAGACATTGGACTTTTATTGGGAATGATCGTCTTTGCTGTTATGTTGTCAATTCTTTCTTTGATTGGGATATTTAACAGATCATTCCGAACTGG

The chromosomal positions for this exon are 67,240,179 through 67,240,281 (i.e., encompassing 67,240,275). The starting point for this exon is at 331bp in one transcript and 1,217bp in the other. These numbers are from adding up the lengths of the exons beforehand.

That chromosomal position is 6bp from the end of this exon. In other words, it appears that your nucleotide positions are referring to different exons; both transcripts share the next exon as well. I would double-check your math with the caveat that I did these calculations by hand with data from Ensembl and am, hopefully, correct.

ADD COMMENT

Login before adding your answer.

Traffic: 1505 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6