Convert A Text File Into A Fasta File

Question

[Zhshqzyc]

Hello, I have a text file likes this:

GTCAAAGATCAGATGGTTGTAGATGTGTGGTGTTATTTCTGAAGCCTCTGTTCAAGGAAGGCAGTTTCTTATGAA

I want to convert it to a fasta file. Can we just manually add a ">" in the fist line?

Thanks

[Thaman]

Just adding ">" is not a solution, you need biological identifier!

Answer 1

[Torst]

A good explaination of the FASTA format is here:

http://en.wikipedia.org/wiki/FASTA_format

Some applications will use the word immediately after the ">" symbols as an "ID" so make sure it means something to you. You that you can put multiple sequences in the one file, just start each new one with a ">" line, and use a unique ID for each one.

Answer 2

[ofanoyi]

Probably you have figured it out.

• http://rocaplab.ocean.washington.edu/tools/genbank_to_fasta
• http://molbiol-tools.ca/Convert.htm
• http://genome.nci.nih.gov/tools/reformat.html
• http://www.hiv.lanl.gov/content/sequence/FORMAT_CONVERSION/form.html
• http://www.ebi.ac.uk/Tools/sfc/readseq/

[ekal]

Following the second link, I found http://www.ebi.ac.uk/Tools/sfc/emboss_seqret/ which worked for me.

Answer 3

[Linda]

Yes. With some added text to identify the sequence.

Answer 4

[BioApps]

Yes. As you said, the answer is that simple: simply add '>' at the top of your file. Probably, this is the most simple conversion possible !! :) :)

It is not like converting Fasta back to chromatograms :) :) :)

[Matt Shirley]

How the hell would you do that, and why? It looks like you would have to make up the intensity values, and again - why?

[BioApps]

Yes. You are right. The values are 'made up'. The program is just a joke. I had available a library that read FASTA and one that generated SCF files. I only spent few minutes to put them together :) :) :)