What is the meaning of 'Error running 'prep_reads'?

Question

[zizigolu]

Hi friends,

I was running the tophat2 but I got error. Do you know the reason please?

[izadi@lbox161 bowtie2-2.2.5]$ $TOP/tophat2 -p 8 -G genes.gtf -o /usr/data/nfs6/izadi/angel/ouput genome SRR1944942_trimmed_unmapped.fastq
[2015-09-05 14:38:53] Beginning TopHat run (v2.1.0)
-----------------------------------------------
[2015-09-05 14:38:53] Checking for Bowtie
          Bowtie version:     2.2.5.0
[2015-09-05 14:38:53] Checking for Bowtie index files (genome)..
[2015-09-05 14:38:53] Checking for reference FASTA file
[2015-09-05 14:38:53] Generating SAM header for genome
[2015-09-05 14:38:53] Reading known junctions from GTF file
[2015-09-05 14:38:53] Preparing reads
    [FAILED]
Error running 'prep_reads'
Error: beginning of quality values record not found! (@@?ADDDDBFHFH@FHBC:CIGEEHAC@FGDD?BDFGHGHEIIIDHEFC@)

[Pierre Lindenbaum]

What have you explored, How do you interpret the error message ?

[zizigolu]

Sorry Pierre, actually I don't know

I tried

[izadi@lbox161 bowtie2-2.2.5]$ grep -A4 @@?ADDDDBFHFH@FHBC:CIGEEHAC@FGDD?BDFGHGHEIIIDHEFC@ SRR1944942_trimmed_unmapped.fastq
@@?ADDDDBFHFH@FHBC:CIGEEHAC@FGDD?BDFGHGHEIIIDHEFC@
@SRR1944942.3556091 H134:111:COBYJACXX:2:1107:2281:140117 length=50
CACTCTTCCAGTTTGATTGACTCCTTGAGTTCTGCCGTTCAAGGTTTGGT
+SRR1944942.3556091 H134:111:COBYJACXX:2:1107:2281:140117 length=50
CCCFFFFFHHHFHIIJJJJJJJJJJJJIJJIIJJJJJGIIIIIJHIJJJJ

but the same error

then I tried

[izadi@lbox161 bowtie2-2.2.5]$ cat SRR1944936_trimmed_unmapped.fastq | paste - - - - | awk ' $1 ~ /^@HWI/ && $3 ~/^+/' | sed 's/\t/\n/g' > QC_filtered.fastq

Again the same error. If possible may you please tell me the reason?

[zizigolu]

Pierre,

I tried with original fastq (without adapter trimming) then worked but I don't the reason yet. Does this mean that the adapter trimming cause this error?

Answer 1

[piet]

In which line number does the erroneous quality string occur?

grep -n '@@?ADDDDBFHFH@FHBC:CIGEEHAC@FGDD?BDFGHGHEIIIDHEFC@' SRR1944942_trimmed_unmapped.fastq

Is the line number a multiple of 4?

[zizigolu]

Sorry I can't get you. I used these codes from biostars and I can't interpret them

[Devon Ryan]

Do you understand what the command is doing and why piet asked whether the resulting number is a multiple of 4?

[zizigolu]

No Devon I could not. May you tell me please

[Devon Ryan]

man grep

Then describe the fastq format.