how do KOG classification and KEGG analysis based on nucleotide sequences?

Question

[Kurban]

Hello guys,

I have more than 400 up regulated transcripts sequences from my insect transcriptome data. If I wanna do KOG classification and KEGG analysis according to their sequences how should I do that? Could u give me some tips?

Thanks in advance

[5heikki]

Have you read this?

[Kurban]

thanks @5heikki,

I downloaded Kog_LE.tar.gz file from ftp://ftp.ncbi.nih.gov/pub/mmdb/cdd/little_endian/ and did rpsblast:

rpsblast -i golf-4-down-and-DEseq-down-intersection.fasta -d Kog -m 2 -e 0.01 -a 3 -o golf-4-down-and-DEseq-down-intersection_Kog_results

and got the result:

	kurban@kurban-X550VC:~/Desktop/kog_classification$ more golf-4-down-and-DEseq-down-intersection_Kog_resultsRPS-BLAST 2.2.26 [Sep-21-2011]
	Database: KOG.v1.0
	4825 sequences; 2,331,573 total letters
	Searching..................................................done
	Query= TR24847|c0_g1_i1
	(6508 letters)
	Score E
	Sequences producing significant alignments: (bits) Value
	gnl|CDD|231029 KOG3091, KOG3091, KOG3091, Nuclear pore complex, ... 53 1e-06
	gnl|CDD|229161 KOG1219, KOG1219, KOG1219, Uncharacterized conser... 52 4e-06
	gnl|CDD|230324 KOG2385, KOG2385, KOG2385, Uncharacterized conser... 43 0.002
	gnl|CDD|231646 KOG3714, KOG3714, KOG3714, Meprin A metalloprotea... 40 0.009
	1_0 70 TGATGCCAAAAGGCGATTGGGATCGTTAAAAGCCAATCTTTAATTCGTTTAGTTCAGAAA 129
	231029 5 SGSTSgfAAGStGASGgqGNGTSttTSASGGGAfGSqpTTgTAT---TglfGANqAGGTG 62
	\
	|
	F
	231029 3 GASgSTSGfAAG---STgASgGqgNfGTSTTtSAsGGGAf 39
	231029 3 GASG 6
	1_0 130 TTCATTGTCCGGATTTCATTGCTTGGTCGGTGATGGGAATGACTTGCACAAGTGCTCACA 189
	231029 63 fgtASTGTAAGSGfgTsTATGAggGGSqSGqqlgGlGG 102
	\
	|
	FF
	231029 40 gSqpTTGT----ATTglfgAN-qAGGTgfGT-AStGtAAgSGfgTStAtGAGgGffgSqS 93
	231029 5 SGsTSGfAAGSTGASGGqGnfGTsTTtsA-----------S 34
	231029 7 STsGfAAgs-tGASggqGNfGtSTttSASGgGAfGSqpTTGTATTGlf-----------G 54
	1_0 190 AGTCGGGCAGCCTACTGGAAAAACCAGTGCACTTGTAATGATGATTTAGACTGAGGAGCC 249
	231029 3 GASGST--SGfAAGsTgASGGqGnfGTSTTTSA--SGGGAf-- 39
	231029 94 GqqlGGlgGt 103
	--More--(0%)
	kurban@kurban-X550VC:~/Desktop/kog_classification$ rpsblast -i golf-4-down-and-DEseq-down-intersection.fasta -d Kog -m 9 -e 0.01 -a 3 -o golf-4-down-and-DEseq-down-intersection_Kog_results
	kurban@kurban-X550VC:~/Desktop/kog_classification$ more golf-4-down-and-DEseq-down-intersection_Kog_results# RPSBLAST 2.2.26 [Sep-21-2011]
	# Query: TR24847|c0_g1_i1
	# Database: Kog
	# Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score
	TR24847|c0_g1_i1 gnl|CDD|231029 34.74 95 50 3 776 868 3 87 1e-06 52.5
	TR24847|c0_g1_i1 gnl|CDD|231029 30.69 101 64 3 70 167 5 102 3e-06 51.4
	TR24847|c0_g1_i1 gnl|CDD|231029 28.57 126 63 4 2286 2410 3 102 3e-06 51.4
	TR24847|c0_g1_i1 gnl|CDD|231029 25.74 101 73 1 5481 5579 3 103 5e-06 50.6
	TR24847|c0_g1_i1 gnl|CDD|231029 24.64 138 89 4 5230 5359 3 133 9e-06 49.8
	TR24847|c0_g1_i1 gnl|CDD|231029 37.21 86 48 3 5470 5555 6 85 1e-05 49.5
	TR24847|c0_g1_i1 gnl|CDD|231029 33.33 93 58 2 5460 5550 13 103 2e-05 48.7
	TR24847|c0_g1_i1 gnl|CDD|231029 28.30 106 64 3 764 867 8 103 3e-05 48.3
	TR24847|c0_g1_i1 gnl|CDD|231029 29.06 117 79 2 2616 2732 3 115 5e-05 47.5
	TR24847|c0_g1_i1 gnl|CDD|231029 28.35 127 64 4 934 1060 3 102 6e-05 47.1
	TR24847|c0_g1_i1 gnl|CDD|231029 33.75 80 49 1 378 457 11 86 8e-05 46.8
	TR24847|c0_g1_i1 gnl|CDD|231029 24.82 137 76 3 2270 2406 3 112 1e-04 46.4
	TR24847|c0_g1_i1 gnl|CDD|231029 31.96 97 64 2 3203 3298 12 107 1e-04 46.0
	TR24847|c0_g1_i1 gnl|CDD|231029 29.66 118 66 6 207 324 3 103 2e-04 45.6
	TR24847|c0_g1_i1 gnl|CDD|231029 24.59 122 71 2 5655 5776 3 103 2e-04 45.6
	TR24847|c0_g1_i1 gnl|CDD|231029 18.78 197 138 5 888 1084 4 178 2e-04 45.2
	TR24847|c0_g1_i1 gnl|CDD|231029 24.50 151 90 4 1974 2124 4 130 2e-04 45.2
	TR24847|c0_g1_i1 gnl|CDD|231029 26.36 110 70 2 5904 6013 5 103 3e-04 44.8
	TR24847|c0_g1_i1 gnl|CDD|231029 31.82 110 66 4 90 199 3 103 4e-04 44.4
	TR24847|c0_g1_i1 gnl|CDD|231029 31.43 105 52 3 3275 3378 7 92 4e-04 44.4
	TR24847|c0_g1_i1 gnl|CDD|231029 32.00 100 61 3 4949 5045 7 102 4e-04 44.4
	TR24847|c0_g1_i1 gnl|CDD|231029 26.36 129 67 2 6230 6358 3 103 4e-04 44.4
	TR24847|c0_g1_i1 gnl|CDD|231029 30.10 103 69 3 2647 2748 3 103 4e-04 44.4
	TR24847|c0_g1_i1 gnl|CDD|231029 31.33 83 54 1 3566 3648 6 85 6e-04 44.1
	TR24847|c0_g1_i1 gnl|CDD|231029 30.49 82 51 2 3790 3865 3 84 6e-04 44.1
	TR24847|c0_g1_i1 gnl|CDD|231029 19.27 109 79 2 5823 5931 3 102 6e-04 43.7
	TR24847|c0_g1_i1 gnl|CDD|231029 26.53 98 58 3 2265 2362 11 94 6e-04 43.7
	TR24847|c0_g1_i1 gnl|CDD|231029 30.00 100 62 2 5267 5363 8 102 7e-04 43.7
	TR24847|c0_g1_i1 gnl|CDD|231029 27.27 99 70 1 584 682 3 99 9e-04 43.3
	TR24847|c0_g1_i1 gnl|CDD|231029 29.36 109 63 3 5588 5691 4 103 0.001 43.3
	TR24847|c0_g1_i1 gnl|CDD|231029 23.16 95 69 2 335 427 11 103 0.001 42.9
	TR24847|c0_g1_i1 gnl|CDD|231029 25.25 99 70 2 2087 2185 4 98 0.001 42.9
	TR24847|c0_g1_i1 gnl|CDD|231029 27.84 97 59 2 2052 2140 10 103 0.001 42.9
	TR24847|c0_g1_i1 gnl|CDD|231029 23.89 113 71 2 3458 3568 3 102 0.001 42.9
	TR24847|c0_g1_i1 gnl|CDD|231029 25.22 115 69 2 5711 5825 6 103 0.001 42.5
	TR24847|c0_g1_i1 gnl|CDD|231029 25.47 106 73 2 5192 5296 3 103 0.002 42.5
	--More--(2%)

view raw biostars-162418.sh hosted with ❤ by GitHub

in query file, there are 60 sequences, but most of them aligned to gnl|CDD|231029 (Nuclear pore complex) with lowest e-value and highest score.my questions here are: did I do KOG classification correctly? if I did what is the proper interpretation of the result file? or is there something else I should do for making the rpsblast results little more understandable?

[Kurban]

thanks @Michael Dondrup,

yeah, i did used the nucleotide sequences as query file and after i added the -p argument that worked fine.

hey Micheal, when you do Kog what e-value do u use to get an acceptable results?

[Michael]

1e-6 is often used, but these alignments can be short and bad, 1e-10 is a more conservative cutoff. There are many sequenced insects and Drosophila is a model organism. I'd expect to see a lot of hits with 1e-50 or better.

Answer 1

[Michael]

It seems like you did an untranslated nucleotide search with rpsblast against a protein db, so your result is bogus. You are using legacy rpsblast which had an option:

 -p  Query sequence is protein  [T/F]  Optional
    default = T

Try to set this to F, then it might do the translation.

For Kegg analysis you should use KAAS which can handle nucleotide input.