How to interpret positive and negative POS values in alternative alignment field?

Question

[StarCute]

gi|110640213|ref|NC_008253.1|_4832863_4833322_0:0:0_0:0:0_11    163     gi|110640213|ref|NC_008253.1|   4832863 23      70M     =       4833253 460     TACCGCAATGTGCTTATTGAAGATGACCAGGGAACGCATTTCCGGCTGGTTATCCGCAATGCCGGAGGGC  2222222222222222222222222222222222222222222222222222222222222222222222  XT:A:U  NM:i:0  SM:i:23 AM:i:0  X0:i:1  X1:i:1  XM:i:0  XO:i:0  XG:i:0  MD:Z:70 XA:Z:gi|110640213|ref|NC_008253.1|,+4019608,70M,1;

Suppose I have the following alignment (illustrated above). As you can see there are multiple alignments in the form (rname, pos, cigar, NM), where NM defines edit distance. I have noticed that the pos field can either be positive or negative.

Where do positional values beginning with a positive or negative sign start in the sequence specified by rname?

[Brian Bushnell]

The XA flag is not part of the sam specification; it's a custom extension specific to the aligner. What program are you using?

[StarCute]

BWA.

[StarCute]

I'd like to assume that it refers to the positive and negative strand, but I can't find anything confirming that.

[Istvan Albert]

Since this is a non standard field I think one needs to do a bit a reverse engineering to find out how exactly is created. It makes sense that it would be the strand since neither of the other fields specify that information yet it is important to know.

Answer 1

[StarCute]

Following the advice given from Brian Bushnell and Istvan Albert, I was able to find the block of code that produce the multiple hits. Under bwa/bwase.c, beginning at line 467, we can see that, in fact, the + and - signs refer to the positive and negative strands.