hello,
I would like to convert my sam file (.sam) to another type is .axt format.
i used BWA for alignement but the output of this tool is .sam format.
Can you help me?
Thanks
hello,
I would like to convert my sam file (.sam) to another type is .axt format.
i used BWA for alignement but the output of this tool is .sam format.
Can you help me?
Thanks
I quickly wrote a converter https://github.com/lindenb/jvarkit/wiki/Biostar170742
$ java -jar dist-2.0.1/biostar170742.jar \
-R ref.fa \
S1.bam
0 rotavirus 1 70 rotavirus_1_317_5:0:0_7:0:0_2de/1 + 60
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGCAGATGGTAAGCTCTATTATT
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAATATGGCGTCAACTCAGCAGATGGTCAGCTCTAATATT
1 rotavirus 1 70 rotavirus_1_535_4:0:0_4:0:0_1a6/2 + 60
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGCAGATGGTAAGCTCTATTATT
GGCTTTTACTGCTTTTCAGTGGTTGCTTCTCAAGATGGAGTGTACTCATCAGATGGTAAGCTCTATTATT
2 rotavirus 1 70 rotavirus_1_543_5:0:0_11:0:0_390/2 + 60
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGCAGATGGTAAGCTCTATTATT
GGCTTTTAATGCTTTTCATTTGATGCTGCTCAAGATGGAGTCTACACAGCAGATGGTCAGCTCTATTATT
3 rotavirus 1 70 rotavirus_1_578_3:0:0_7:0:0_7c/1 + 60
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGCAGATGGTAAGCTCTATTATT
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTCCTGAGCAGCTGGTAAGCTCTATTATT
(...)
I installed the tool. but I can't run Biostar70742.java
there are errors.
[m@rainman biostar]$ javac Biostar170742.java
Biostar170742.java:29: package com.github.lindenb.jvarkit.util.picard does not exist | |
import com.github.lindenb.jvarkit.util.picard.GenomicSequence; | |
^ | |
Biostar170742.java:30: package com.github.lindenb.jvarkit.util.picard does not exist | |
import com.github.lindenb.jvarkit.util.picard.SAMSequenceDictionaryProgress; | |
^ | |
Biostar170742.java:32: package htsjdk.samtools does not exist | |
import htsjdk.samtools.Cigar; | |
^ | |
Biostar170742.java:33: package htsjdk.samtools does not exist | |
import htsjdk.samtools.CigarElement; | |
^ | |
Biostar170742.java:34: package htsjdk.samtools does not exist | |
import htsjdk.samtools.CigarOperator; | |
^ | |
Biostar170742.java:35: package htsjdk.samtools does not exist | |
import htsjdk.samtools.SAMRecord; | |
^ | |
Biostar170742.java:36: package htsjdk.samtools does not exist | |
import htsjdk.samtools.SAMRecordIterator; | |
^ | |
Biostar170742.java:37: package htsjdk.samtools does not exist | |
import htsjdk.samtools.SamReader; | |
^ | |
Biostar170742.java:38: package htsjdk.samtools.reference does not exist | |
import htsjdk.samtools.reference.IndexedFastaSequenceFile; | |
^ | |
Biostar170742.java:39: package htsjdk.samtools.util does not exist | |
import htsjdk.samtools.util.CloserUtil; | |
^ | |
Biostar170742.java:42: cannot find symbol | |
symbol: class AbstractBiostar170742 | |
public class Biostar170742 extends AbstractBiostar170742 | |
^ | |
Biostar170742.java:44: package org.slf4j does not exist | |
private static final org.slf4j.Logger LOG = com.github.lindenb.jvarkit.util.log.Logging.getLog(Biostar170742.class); | |
^ | |
Biostar170742.java:44: package com.github.lindenb.jvarkit.util.log does not exist | |
private static final org.slf4j.Logger LOG = com.github.lindenb.jvarkit.util.log.Logging.getLog(Biostar170742.class); | |
^ | |
Biostar170742.java:51: cannot find symbol | |
symbol : variable super | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
if(super.faidx==null) | |
^ | |
Biostar170742.java:53: cannot find symbol | |
symbol : method wrapException(java.lang.String) | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
return wrapException("Reference sequence was not defined"); | |
^ | |
Biostar170742.java:56: cannot find symbol | |
symbol : class SamReader | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
SamReader sfr=null; | |
^ | |
Biostar170742.java:57: cannot find symbol | |
symbol : class SAMRecordIterator | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
SAMRecordIterator iter=null; | |
^ | |
Biostar170742.java:58: cannot find symbol | |
symbol : class GenomicSequence | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
GenomicSequence genomicSequence = null; | |
^ | |
Biostar170742.java:59: cannot find symbol | |
symbol : class IndexedFastaSequenceFile | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
IndexedFastaSequenceFile indexedFastaSequenceFile= null; | |
^ | |
Biostar170742.java:62: cannot find symbol | |
symbol : class IndexedFastaSequenceFile | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
indexedFastaSequenceFile = new IndexedFastaSequenceFile(super.faidx); | |
^ | |
Biostar170742.java:62: cannot find symbol | |
symbol : variable super | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
indexedFastaSequenceFile = new IndexedFastaSequenceFile(super.faidx); | |
^ | |
Biostar170742.java:64: cannot find symbol | |
symbol : method openSamReader(java.lang.String) | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
sfr = openSamReader(inputName); | |
^ | |
Biostar170742.java:65: cannot find symbol | |
symbol : variable super | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
out = super.openFileOrStdoutAsPrintStream(); | |
^ | |
Biostar170742.java:69: cannot find symbol | |
symbol : class SAMSequenceDictionaryProgress | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
final SAMSequenceDictionaryProgress progress = new SAMSequenceDictionaryProgress(sfr.getFileHeader()); | |
^ | |
Biostar170742.java:69: cannot find symbol | |
symbol : class SAMSequenceDictionaryProgress | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
final SAMSequenceDictionaryProgress progress = new SAMSequenceDictionaryProgress(sfr.getFileHeader()); | |
^ | |
Biostar170742.java:73: cannot find symbol | |
symbol : class SAMRecord | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
final SAMRecord rec= progress.watch(iter.next()); | |
^ | |
Biostar170742.java:75: cannot find symbol | |
symbol : class Cigar | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
final Cigar cigar = rec.getCigar(); | |
^ | |
Biostar170742.java:82: cannot find symbol | |
symbol : class GenomicSequence | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
genomicSequence = new GenomicSequence(indexedFastaSequenceFile, rec.getReferenceName()); | |
^ | |
Biostar170742.java:89: cannot find symbol | |
symbol : class CigarElement | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
for(final CigarElement ce: cigar.getCigarElements()) | |
^ | |
Biostar170742.java:91: cannot find symbol | |
symbol : class CigarOperator | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
final CigarOperator op = ce.getOperator(); | |
^ | |
Biostar170742.java:92: cannot find symbol | |
symbol : variable CigarOperator | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
if(op.equals(CigarOperator.S)) | |
^ | |
Biostar170742.java:94: operator + cannot be applied to int,CigarElement.getLength | |
readpos+=ce.getLength(); | |
^ | |
Biostar170742.java:94: inconvertible types | |
found : <nulltype> | |
required: int | |
readpos+=ce.getLength(); | |
^ | |
Biostar170742.java:97: cannot find symbol | |
symbol : variable CigarOperator | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
if(op.equals(CigarOperator.H)) | |
^ | |
Biostar170742.java:163: cannot find symbol | |
symbol : variable RETURN_OK | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
return RETURN_OK; | |
^ | |
Biostar170742.java:167: cannot find symbol | |
symbol : method wrapException(java.lang.Exception) | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
return wrapException(err); | |
^ | |
Biostar170742.java:171: cannot find symbol | |
symbol : variable CloserUtil | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
CloserUtil.close(out); | |
^ | |
Biostar170742.java:172: cannot find symbol | |
symbol : variable CloserUtil | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
CloserUtil.close(iter); | |
^ | |
Biostar170742.java:173: cannot find symbol | |
symbol : variable CloserUtil | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
CloserUtil.close(sfr); | |
^ | |
Biostar170742.java:174: cannot find symbol | |
symbol : variable CloserUtil | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
CloserUtil.close(indexedFastaSequenceFile); | |
^ | |
Biostar170742.java:49: method does not override or implement a method from a supertype | |
@Override | |
^ | |
Biostar170742.java:180: cannot find symbol | |
symbol : method instanceMain(java.lang.String[]) | |
location: class com.github.lindenb.jvarkit.tools.biostar.Biostar170742 | |
new Biostar170742().instanceMain(args); | |
^ | |
42 errors |
you didn't follow the instructions: https://github.com/lindenb/jvarkit/wiki/Biostar170742
make biostar170742
same problem BUILD Failed.
[mk@rainman jvarkit]$ make biostar170742
echo "Compiling htsjdk with ${JAVA_HOME} = "
Compiling htsjdk with =
echo "Compiling htsjdk library for java. Requires apache ANT. If it fails here, it's a not a problem with jvarkit."
Compiling htsjdk library for java. Requires apache ANT. If it fails here, it's a not a problem with jvarkit.
echo "And ${JAVA_HOME}/bin/javac should be >=1.8"
And /bin/javac should be >=1.8
(cd /home/mk/jvarkit/htsjdk-2.0.1 && ant )
Buildfile: build.xml
write-version-property:
BUILD FAILED
/home/mk/jvarkit/htsjdk-2.0.1/build.xml:64: Problem: failed to create task or type propertyfile
Cause: the class org.apache.tools.ant.taskdefs.optional.PropertyFile was not found.
This looks like one of Ant's optional components.
Action: Check that the appropriate optional JAR exists in
-/usr/share/ant/lib
-/home/mk/.ant/lib
-a directory added on the command line with the -lib argument
Do not panic, this is a common problem.
The commonest cause is a missing JAR.
This is not a bug; it is a configuration problem
Total time: 0 seconds
make: *** [/home/mk/jvarkit/htsjdk-2.0.1/dist/htsjdk-2.0.1.jar] Erreur 1
[mk@rainman jvarkit]$
forgot to put the read positions: udpated the source https://github.com/lindenb/jvarkit/commit/84dfac8015be3ae66cdb15b25618022198b8f106
Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
does AXT supports INDELS (like SAM)?
yes. it support indels
so, how does it look likes with indels, I cannot find an example
this is an example:
so how convert
.sam
output to.axt
?i cant install ant in my server!!! have you solution?
you don't need to be root to install ant, just download and put it anywhere: https://ant.apache.org/bindownload.cgi
I installed apache.
but no run to biostar170742.
https://ant.apache.org/manual/install.html#optionalTasks
thank you but I cant install apache. I don't know the problem
have you another solution to run samtoaxt.java?
Thanks