Finding hg19 coordinates for primers to make BED file

Question

[adnan.haider.ra]

Hello everyone!

As title suggests, I have designed primers for a gene (BRCA1) with help of ExonPrimer using hg19 as template. Problem is that in order to make manifest file in Illumina Experiment Manager (IEM) for PCR Amplicon Workflow, I need to have hg19 start and end co-ordinates of my amplicons but I have not been suplied this bit of information. So, is there any way of getting co-ordinates with help of forward and reverse primer sequences?

For Example, I have been supplied this bit of information for exon1 of BRCA1 gene,

Assembly                      Feb. 2009 (GRCh.37/hg19)
UCSC ID                       uc002icq.3
RefSeq   (Accession#)         NM_007294
Description                   Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 1, mRNA
Link:                         http://genome.ucsc.edu/cgi-bin/hgGene?hgg_gene=uc002icq.3&hgg_prot=P38398&hgg_chrom=chr17&hgg_start=41196311&hgg_end=41277500&hgg_type=knownGene&db=hg19&hgsid=465092029_PO9baMwFwF3f1U3frs2NPFn2sAJL
Transcript (Including UTRs)   Position: chr17:41,196,312-41,277,500 Size: 81,189 Total Exon Count: 23
Coding Region                 Position: chr17:41,197,695-41,276,113 Size: 78,419 Coding Exon Count: 22


Codon   Exon Size   Product Size  Start (left)  End (Right)  Forward Primer           Reverse Primer
2       80 bp       832           2223          3054         GGACGTTGTCATTAGTTCTTTGG  caacatctgcctcctggttc

[Devon Ryan]

How many primers do you have? If you only have a few then you could just blast them online.

[bioinfo89]

Hi,

I have a similar query!! I have forward and reverse primers for 400 amplicons and I want to extract the start and end coordinates of the primers to soft clip them. Is there a way to do this?

I checked Insilco PCR. It does not provide the coordinates for primers!

Thanks!

[WouterDeCoster]

Please use ADD COMMENT or ADD REPLY to answer to previous reactions, as such this thread remains logically structured and easy to follow. I have now moved your reaction but as you can see it's not optimal. Adding an answer should only be used for providing a solution to the question asked.

This might be more appropriate as a separate question.

Answer 1

[igor]

The easiest way (if you only have a few sequences) to convert from primers to coordinates is to use UCSC In-Silico PCR: http://genome.ucsc.edu/cgi-bin/hgPcr

[adnan.haider.ra]

Thanks a lot @igor :)