gap filling solution

0

Entering edit mode

8.9 years ago

Bulbul Ahmed ▴ 20

It is the head of a big sequence. How will I remove the extra 1,2 from the sequence and fill the gap?

sequence • 2.3k views

ADD COMMENT • link updated 2.3 years ago by Ram 44k • written 8.9 years ago by Bulbul Ahmed ▴ 20

2

Entering edit mode

Please use complete words and sentences and take appropriate time to revise your question. Questions that are not intelligible may be closed for this reason.

ADD REPLY • link updated 4.9 years ago by Ram 44k • written 8.9 years ago by Michael 55k

1

Entering edit mode

Could you add detail and clarify your question?

ADD REPLY • link 8.9 years ago by Sean Davis 27k

0

Entering edit mode

@SRR1532157.1 1 length=100
______________^
GAAGTTTAGGCGGTGCATACGGAGCTGGC
+SRRSRR1532157.1 1 length=100
_________________^
GG>BGGGDEGGBGBGDFFFFGBGGBGGEG

the highlighted 1... how will I remove???

ADD REPLY • link updated 4.9 years ago by Ram 44k • written 8.9 years ago by Bulbul Ahmed ▴ 20

1

Entering edit mode

Ah, so we know for the first time it's fastq, and that you want to change the fastq record headers, and it has nothing to with 'gaps' in the sense the term is normally used in bioinformatics. Thanx ;)

ADD REPLY • link 8.9 years ago by Michael 55k

Login before adding your answer.