GEO (NCBI) confusing data

Question

[silas008]

Hi,

I'm have some problems with one data shared on GEO:

In this link: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE19414, we can find a list of 26 samples. Clicking on one of that, for example GSM503820, which links to http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM503820, and clicking on the ftp download link, in the bottom of the page, we can download a fasta file that contains in the first line a number and in the second line a read. I think that the first line is the count of the read specified in the second line. But is confusing because, on GEO, the data is normally provided in SRA or FASTQ format.

If I'm right about this fasta file, can I convert it on fastq file?

Thank you very much

[silas008]

A part of the fasta file:

>3
ATTGCAATGAAGTCGTCGCTCT
>4
GAGGAAGGATAAAGATAAGC
>5
GAATCATAAGACTACTAATTA
>14
CATATCAATGTCATGGAAGAA
>31
ATCATCATTCTCCTTTTTCA
>36
GAGAGCAAATTGGAGTAATCAA

[Sean Davis]

What is it that you want to do with the data? Fastq contains quality information in addition to just sequence, so you will not be able to convert directly.

Answer 1

[h.mon]

Why do you need to convert to fastq, can't you use fasta?

I guess qualities were not provided as typically the quality of the first 30 bases or so is high, above 30. You may convert using mock qualities, see suggestions here and here.