De Novo Small Rna Transcriptome Assembly For Non-Model Species?

Question

[Ahdf-Lell-Kocks]

What are the recommended tools for de novo assembly of Illumina sequencing of small RNAs (like miRNAs, snoRNAs, etc) of a read length of 36bp for a eukaryote multicellular species without a reference genome?

I tried the latest version of Trinity with default parameters on the public dataset from the SRA:

http://www.ncbi.nlm.nih.gov/sra?term=SRR057742

And it only gives me 1 transcript back:

~/trinityrnaseq_r2012-01-25/Trinity.pl --kmer_method meryl \
--seqType fq --single SRR057742.fastq --CPU 1

>comp1_c0_seq1 len=206 path=[1:0-205]
AAGCAGAAGACGGCATACGACCAAGGCCTCTAGTCATTCGCTTTACCGGATAAAACTGCT
CAGCGAGCGCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTACTAGATGGTTCGA
TTAGTCTTTCGCCCCTATACCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTGCGG
GCCTCCACCAGAGTTTCCCCTGGCTT

Any ideas what I can try?

[Nicolas Rosewick]

it depends on how the libraire is prepared. In general, with small RNA sequencing, the librairie is enriched in miRNA and other small ncRNA. So the lib is not mRNA enriched.

[bioming]

What does the parameters of trinity mean? K=25 --seqType fq --min_contig_length 100 --min_glue 4 --group_pairs_distance 250 --min_kmer_cov 4

[Devon Ryan]

Please post this as a new question.

Answer 1

[Nicolas Rosewick]

Try Trinity: http://trinityrnaseq.sourceforge.net/

[Ahdf-Lell-Kocks]

Thanks for the suggestion. I tried it with default parameters but didn't get much out from it... Any suggestions?

Answer 2

[Pasta]

Try Edena if you are working with prokaryotes