I loaded a DNA-seq BAM file in IGV but I can't see anything

Question

[grosfish69]

I loaded a BAM file in IGV but I can't see anything. My reference genome is Human hg19. I don't know which chromosome to choose and which region to zoom in.

I tried to read the BAM file header with samtools but I don't understand what information to extract:

I wrote that in the terminal

 samtools view -h [bamfile] | head -100

OUTPUT

 aln.bam | head -88
@HD VN:1.0  SO:unsorted

@SQ SN:1    LN:249250621

@SQ SN:2    LN:243199373

@SQ SN:3    LN:198022430

@SQ SN:4    LN:191154276

@SQ SN:5    LN:180915260

@SQ SN:6    LN:171115067

@SQ SN:7    LN:159138663

@SQ SN:8    LN:146364022

@SQ SN:9    LN:141213431

@SQ SN:10   LN:135534747

@SQ SN:11   LN:135006516

@SQ SN:12   LN:133851895

@SQ SN:13   LN:115169878

@SQ SN:14   LN:107349540

@SQ SN:15   LN:102531392

@SQ SN:16   LN:90354753

@SQ SN:17   LN:81195210

@SQ SN:18   LN:78077248

@SQ SN:19   LN:59128983

@SQ SN:20   LN:63025520

@SQ SN:21   LN:48129895

@SQ SN:22   LN:51304566

@SQ SN:X    LN:155270560

@SQ SN:Y    LN:59373566

@SQ SN:MT   LN:16569

@SQ SN:GL000207.1   LN:4262

@SQ SN:GL000226.1   LN:15008

@SQ SN:GL000229.1   LN:19913

@SQ SN:GL000231.1   LN:27386

@SQ SN:GL000210.1   LN:27682

@SQ SN:GL000239.1   LN:33824

@SQ SN:GL000235.1   LN:34474

@SQ SN:GL000201.1   LN:36148

@SQ SN:GL000247.1   LN:36422

@SQ SN:GL000245.1   LN:36651

@SQ SN:GL000197.1   LN:37175

@SQ SN:GL000203.1   LN:37498

@SQ SN:GL000246.1   LN:38154

@SQ SN:GL000249.1   LN:38502

@SQ SN:GL000196.1   LN:38914

@SQ SN:GL000248.1   LN:39786

@SQ SN:GL000244.1   LN:39929

@SQ SN:GL000238.1   LN:39939

@SQ SN:GL000202.1   LN:40103

@SQ SN:GL000234.1   LN:40531

@SQ SN:GL000232.1   LN:40652

@SQ SN:GL000206.1   LN:41001

@SQ SN:GL000240.1   LN:41933

@SQ SN:GL000236.1   LN:41934

@SQ SN:GL000241.1   LN:42152

@SQ SN:GL000243.1   LN:43341

@SQ SN:GL000242.1   LN:43523

@SQ SN:GL000230.1   LN:43691

@SQ SN:GL000237.1   LN:45867

@SQ SN:GL000233.1   LN:45941

@SQ SN:GL000204.1   LN:81310

@SQ SN:GL000198.1   LN:90085

@SQ SN:GL000208.1   LN:92689

@SQ SN:GL000191.1   LN:106433

@SQ SN:GL000227.1   LN:128374

@SQ SN:GL000228.1   LN:129120

@SQ SN:GL000214.1   LN:137718

@SQ SN:GL000221.1   LN:155397

@SQ SN:GL000209.1   LN:159169

@SQ SN:GL000218.1   LN:161147

@SQ SN:GL000220.1   LN:161802

@SQ SN:GL000213.1   LN:164239

@SQ SN:GL000211.1   LN:166566

@SQ SN:GL000199.1   LN:169874

@SQ SN:GL000217.1   LN:172149

@SQ SN:GL000216.1   LN:172294

@SQ SN:GL000215.1   LN:172545

@SQ SN:GL000205.1   LN:174588

@SQ SN:GL000219.1   LN:179198

@SQ SN:GL000224.1   LN:179693

@SQ SN:GL000223.1   LN:180455

@SQ SN:GL000195.1   LN:182896

@SQ SN:GL000212.1   LN:186858

@SQ SN:GL000222.1   LN:186861

@SQ SN:GL000200.1   LN:187035

@SQ SN:GL000193.1   LN:189789

@SQ SN:GL000194.1   LN:191469

@SQ SN:GL000225.1   LN:211173

@SQ SN:GL000192.1   LN:547496

@RG ID:Bordet_EGFR_S1   SM:S1   PL:Illumina

@PG ID:bowtie2  PN:bowtie2  VN:2.0.2
M01636:3:000000000-A442D:1:1102:18789:14479 99  1   326181  1   11S140M =   326217  189 CACACTGACGTGCCTCTCCAGACCCACTTGCACCCTCCGGGCGTTCTCTCCGGGCCCAGCTCTTCTTCCTGGTTGGGTCTCCAGGCCCGATTCCTGCCTCTCAACAACCTCTTTGGACTCAGTGCCTACCCATCTCCTGGCGGCCTTGGTC BBBBBFFFFBBAEGGGGGGGGGGHHHCFHHHGHHGHGGGGGGGGCFFHHHHGGGGEGDHHGFGG3FGHHHFEGHEGGGGHHFHHGEFFGGGGH4FGEGFFHGHFGHFHGHHHFHGHHGHHHFBHHFHBHHGHHHHHFFFHG-CGGDGFHHB AS:i:280    XS:i:280    XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:140    YS:i:275    YT:Z:CP RG:Z:Bordet_EGFR_S1

How to find the correct chromosome and the region of interest?

Thanks

Answer 1

[mastal511]

I think you need to sort and index the bam file using samtools before you can see anything in IGV.

[grosfish69]

@mastal511 I have the [bam.bai] file in the same folder as the bam file. Is that what I have to do? How do I sort the bam file?

[GenoMax]

Did you sort the BAM file before indexing it (which creates the .bai file)?

[grosfish69]

Actually my instructor sent me 4 files:

- aln1.fastq
- aln2.fastq
- aln.bam
- aln.bam.bai

That's why I was thinking that it was already sorted. As genomax2 said it's maybe because my reference genome is not hg19. How can I set it as reference in samtools?

[GenoMax]

Your BAM file header is showing that it is unsorted. You should sort and then index again.

@HD VN:1.0  SO:unsorted

[Nicolas Rosewick]

samtools sort aln.bam aln.sort
samtools index aln.sort.bam

Answer 2

[GenoMax]

In addition to @mastal511's suggestion it looks like you have "ensembl" version of the genome/annotation where as the default "genome" in IGV is UCSC (which uses chr1 etc). So you may need to load the ensembl version of hg19 in IGV as a "new genome".

[grosfish69]

@genomax2 I downloaded the hg19 reference genome. How do I set it as new reference?

[GenoMax]

Is your data aligned to ensembl's hg19?

[grosfish69]

The instruction says:

raw file is aligned to hg19 human genome.

[GenoMax]

Sources use different nomenclature for same genome build (e.g. UCSC uses chr1 where as ensembl has just 1).

[Istvan Albert]

actually IGV can handle the chr1 vs 1 matching nowadays (one small step for man, one giant leap for mankind)

Answer 3

[h.mon]

In addition to mastal511 and genomax2 suggestions, have you zoomed enough?