bam-readcount empty output

Question

[daron.6]

Hi,

I am using the great tools bam-readcount (which I really like), but I am having a problem, when I run the tool I got nothing as an output.

I successfully install the program, and I was able to use it on a set of bam file creating by bowtie2. Here is the cmd line.

$ bam-readcount -l position.tab -w 1 -f mygenome.fna myBowtie2BamFile.bam

Then, when I use Bam files coming from segemehl (http://www.bioinf.uni-leipzig.de/Software/segemehl/) I got no output at all, and also no error.

I really don't understand where the problem could come from, here is one row of the bam file.

Thanks for your help.

M00842:144:000000000-AF21A:1:2114:9089:22345 1:N:0:6    321 Chr1    12754960    255 137M    *   0   0   TTTTCTCCCATGTGGTTTTCTTTACTAAGGTTTTTAATGAGGTGATGAATCATGTGTTCTAAGCTTAGACTCTTGAATAAGTCTTGCTCATGAGGTGGAGTATTGATAAAGACTCAAATAAGAAAGGCCTAGTATTG   4@3@B4@B3?334F30FGF?44FG3F4BG3BF3?FEGGFEBFB/1BGH121<@1GFHHH222@@111?G<FF1?11<<<DDD1=GGF11<11=1<0.<../<=B00<0=0=0/000:0GG:000:/..;;C/00<CB   NM:i:6  MD:Z:59C15C11G1T5G11C29 NH:i:1  XI:i:0  XL:i:2  XA:Z:X  XX:i:115    XY:i:251    XQ:i:1  XP:Z:Chr1   XU:i:12754980   XS:i:0

[Pierre Lindenbaum]

what's the content of position.tab please

[daron.6]

Just a regular bed file, it is a list of SNPs of interest. I am looking at the nucleotide frequencies at the given position. But once again, using the bam file coming from bowtie2 bam-readcount is working perfectly. The problem is when I use bam file coming from segemehl.

[Pierre Lindenbaum]

"Just a regular bed file" can you please show us a line on chr1 please

[daron.6]

Sure, here is the input bed file I am giving to bam-readcount

Chr1 12755477 12755478 Chr1 12755536 12755537 Chr1 12755637 12755638 Chr1 12755742 12755743 Chr1 12755758 12755759

[John]

Could you print a row from the other (working) BAM file? That "22345 1:N:0:6" gap in the QNAME is unusual, and i'd like to know if its in the other bam

Answer 1

[michael.ante]

I see two possible sources of error:

First, your read name contains a white space. Although SAM is tab-separated, some tools don't cope with such formatting.

Second, your example read has the flag for "not primary alignment". You may check your whole alignment with RSeQCs bam_stat.py (see here).

Cheers,

Michael

Answer 2

[Chris Miller]

Do both your bams and your bed file use the same nomenclature? (i.e chr1 vs 1 vs Chr1)