How to get sequence using masked repeats?

Question

[Ati]

I have a bed file like :

chr7  109259875  109259938  ENSMUST00000033300  800  +

I want to have sequence of this regions using masked repeats like :

>mm10_ct_polyaclusters_6257_ENSMUST00000033300_range=chr7:109259876-109259938_5'pad=0_3'pad=0_strand=+_repeatMasking=N
ctagcagtgagaagcaagatgagaatctgtaatagcaactgctaagggtgacaagcaaatgtg

Would you please guide me?

[GenoMax]

Is the bed file defining the masked repeat regions of interest and you want to get the sequence defined by that interval with the fastq header in the format shown?

[Ati]

exactly, I want this

Answer 1

[jotan]

You can do this in Galaxy

https://usegalaxy.org/

Upload your bed file (Get Data -> Upload File) using the lefthand menu. Then: Fetch Alignments/Sequences -> Extract Genomic DNA using coordinates from assembled/unassembled genomes

[Ati]

Thanks a lot, it works...