Perl Help to find orf

Question

[ksi216]

Create a new subroutine that accepts a reference to an array containing multiple sequences and returns the first reading frame for each sequence

[Michael]

Hello ksi216!

We believe that this post does not fit the main topic of this site.

This sounds like literal copy paste of homework, what have you tried?

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

[ksi216]

It is a homework assignment, but I'm having trouble. I'm a bioinformatics student. This is what I tried

use strict;
use warnings;

sub revcomp{
    my($DNAin) = @_;
    my($DNAout) = reverse($DNAin);
    $DNAout =~ tr/ACGT/TGCA/;
    return $DNAout;

    my $DNA= "CCTCACACGCCCTGTTCTGGTGTCTGGTCGGATGTGTTGGTCGTGCGCAGATTGGTGCTC"; #declare scalar for seq
    my $rcDNA=recvomp($DNA);
    print "rcDNA\n";
}

[Michael]

This looks like code from your previous assignment but is unrelated to the new assignment, you haven't even created a new subroutine. Unfortunately this format is not really suitable to teach programming from scratch, and I don't want to do your homework completely. I think you have to try harder here, means post some code that is at least close to what is asked for. Hint: what is an "(open) reading frame", does it need to be translated at all? How do you declare a subroutine?