Full header in blastn out6 format ??

Question

[Picasa]

Hello,

Is it possible to get the full header in blastn out6 mode when outputing the result ?

For example, my output looks like:

seq1 GBSQ01012201.1.2324 100.0 297 0 0 1 297 1 2324 -1 0

My database:

GBSQ01012201.1.2324 Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadales;Moraxellaceae;Penicillium janthinellum AAUCAAGUGCCUUAAGGGUGU ...

I would like an output like this:

seq1 GBSQ01012201.1.2324 Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadales;Moraxellaceae;Penicillium janthinellum 100.0 297 0 0 1 297 1 2324 -1 0

Answer 1

[Damian Kao]

You will have to custom define your tab delimited output to include the "stitle" column. For example:

The default columns for outfmt 6 are:

'qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore'

Just add 'stitle' in there. So something like:

-outfmt '6 qseqid sseqid stitle pident length mismatch gapopen qstart qend sstart send evalue bitscore'

[5heikki]

As far as I recall, this only works with 1. NCBI's preformatted BLAST DBs and 2. DBs created from sequence files retrieved from the NCBI when -parse_seqids is used in makeblastdb and the sequence headers follow the gi|acc formatting (so it does not work with e.g. sequences from GenBank assembly dirs).

Answer 2

[5heikki]

If you replace spaces with e.g. underscores, you will see full headers in output. Alternatively, if you create a map file like (id TAB lineage), which you can parse from your headers easily as such:

GBSQ01012201.1.2324    Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadales;Moraxellaceae;Penicillium janthinellum
...

You can join the rest of the header to tabular blast output with join, e.g.

join -1 2 -2 1 -t $'\t' -o. 1.1,1,2,1.3,1.4,1.5,1.6,1.7,1.8,1.9,1.10,1.11,1.12,2.2 <(sort -k2,2 -t $'\t' blastOutput) <(sort -k1,1 -t $'\t' mapfile) > blastOutputWithLineageAtCol13

[Picasa]

Thanks, Ill look at it