I want to Parse Blastn output file which is in Pairwise alignment format and get coordinates of best hits of target genome excluding gaps??

Question

[shahbazmunir11]

Hi, i am working with blastn stand alone version which performs local alignment between query and target. The output was obtained in pairwise alignment format. here is Blastn output sample.

BLASTN 2.2.26 [Sep-21-2011]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.

Query= chr1:27646199-27646677 (478 letters)

Database: HomoSapeinsHg19_WholeGenomeSequence.fa

       93 sequences; 3,137,161,264 total letters

Searching..................................................done

Sequences producing significant alignments:

chromosome Score(bits) E_Value

chr1 46 0.019

target= >chr1

      Length = 249250621

Score = 46.1 bits (23), Expect = 0.019

Identities = 20/23 (86.95%) Strand = Plus / Minus

Query: 352 ggctccctcctcccgcggcccgg 374

        |||||||||||   |||||||||

Sbjct: 100 ggctccct---cccgcggcccgg 123

Expected Output:

i want to parse the pairwise alignment files and get coordinates of target hits without gaps. like

chr1 100 108

chr1 111 123

Any suggestion will be appreciated...thanks in advance

[5heikki]

You want to:

get coordinates of target hits without gaps

Isn't there a gap right there:

Sbjct: 100 ggctccct---cccgcggcccgg 123

?

In case the blast did not run too long, you should really just do it again and use -outfmt 6 for tab separated values that are so much easier to play with.

[shahbazmunir11]

Thanks I find solution using xml output format.