python: Parsing fasta file

Question

[Am.A]

Hi all

How I parse FASTA file to get information about gene location ( i.e. get numbers start of gene and the end)?

 >lcl|NC_000913.3_cds_NP_414542.1_1 [gene=thrL] [protein=thr operon leader peptide] [protein_id=NP_414542.1] [location=190..255]
ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGA

>lcl|NC_000913.3_cds_NP_414547.1_6 [gene=yaaA] [protein=peroxide resistance protein, lowers intracellular iron] [protein_id=NP_414547.1] [location=complement(5683..6459)]
ATGCTGATTCTTATTTCACCTGCGAAAACGCTTGATTACCAAAGCCCGTTGACCACCACGCGCTATACGC
TGCCGGAGCTGTTAGACAATTCCCAGCAGTTGATCCATGAGGCGCGGAAACTGACGCCTCCGCAGATTAG

[Medhat]

you can find exactly what you need in previous question
Correct Way To Parse A Fasta File In Python

bonus

read this

https://github.com/mdshw5/pyfaidx

[WouterDeCoster]

Okay, you have my permission to do so.

But what is the question? Have you tried googling?

[GenoMax]

But you don't have my permission to give OP permission :-)

Unless OP edited the question after you wrote your comment it does appear to have a reasonably clear description. On a serious note, can we have more of what @Medhat did and less of these comments?

[WouterDeCoster]

Indeed, the post was edited and didn't contain a question at all when I placed my comment asking about what the question would be. I realize that my answer (with the edited original post) makes me look like a douche.

[GenoMax]

@Am.a: It generally helps to be explicit about the output you want when you write the original post. For example in this case do you only need

thrL       190..255
yaaA     5683..6459

Answer 1

[second_exon]

If I understood your question correctly, this solution with Python 3.x might help you,

with open("seq.fa") as f:
    for line in f:
        line = line.rstrip()
        if line.startswith('>'):
            line1 = line.split()
            print(": ".join([line1[0], line1[-1].strip('[location=complement()]')])) #add characters you want to strip

Output:

>lcl|NC_000913.3_cds_NP_414542.1_1: 190..255
>lcl|NC_000913.3_cds_NP_414547.1_6: 5683..6459

[WouterDeCoster]

Don't write a parser if it already exists... in this case the answer is SeqIO from Biopython