Query Ucsc With Known Sequence To Get Chr Position

Question

[mathew.nightingale]

Is it possible to query UCSC using mysql to ask what the resulting amplicon would be, sequence, seq length, chr start & stop positions, GC content etc. Similar to what you get when you manually use the In-Silico PCR function on the website.

Ideally I want to supply a file like this (these are dummy sequences)

tcctaacactggccggctcaatggag F1 accaaccagataacaggaag R1 tccacctctgatctgcaaagtgg F2 gctgactttaaaatctgacacca R2

And get an output with all the data.

Thanks

[microfuge]

I was able to something similar using gfPcr utility available downloaded from UCSC website.

gfPcr blat1a.soe.ucsc.edu  17779 /gbdb/hg19  CCCATGAGTGGCTCCTAAAGCAGCTGC  TtACAGATTGATGATGCATGAAATGGGgggtggccaggggtggggggtga output

The output files contains this -

chr22:34304505-34304954 450bp CCCATGAGTGGCTCCTAAAGCAGCTGC TTACAGATTGATGATGCATGAAATGGGGGGTGGCCAGGGGTGGGGGGTGA CtCATGAGTGGCTCCTAAAGCAGCTGCgtggagctgagagcaaagtgctt ggagctctgacatctgggttctggattcaccttaaaagtgaagccaattt ctttgcttcctgtgacggctggtgtttctctgtctgaggaggagcttgct ttgagattacggtacacacttttcagcattgtggggtaagccattctgga taacagaatttctcaaataggataatccaatcccttacagacagcaagtc tttatttttaatctttaaggaatgagggtttctctaggatgttctgtgta cttaccctcactggctcaccatcagcccctggaaaacttcagctgtcata ttgggacgcacaaagcttgttatgaaccagccctgcctttctctgcagtc TCACCCCCCACCCCTGGCCACCCCCCATTTCATGCATCATCAATCTGTAA

Answer 1

[Pierre Lindenbaum]

no, mysql is 'just' a database engine and there is no way(*) to execute a system call from mysql.

Run an EPCR using a standalone program ( like NCBI EPCR ftp://ftp.ncbi.nlm.nih.gov/pub/schuler/e-PCR/ ) and download the amplicon using, e.g. a DAS server How to get the sequence of a genomic region from UCSC?

(*): well , it could be possible with a mysql UDF but the ucsc wouldn't allow it.