Entering edit mode
8.2 years ago
Alex
▴
50
I have a fasta sequence while I don't know the sequence's position,I just want to attach the genome chromosome , position and strand to the isoseq reads,such as like this:
PB.99.1|chr1:11796161-11810824(+)|i1a_c13849/f19p49/1138/RT|m.1 type:confident-complete len:153 strand:+ pos:100-558 ATTCGCTCGATCGCCGACGACTACGCCTGACTATTCGCGTAGCTACGAT
What are you trying to do? why you want to add these information to fasta file?