fasta file title change

Question

[Sean Liang]

Hi there,

I have a fasta file with the format like this:

@t0000001 2137624

TGGAATGTAAAGAAGTATGTAT

@t0000002 926007

TGTGCACGGCACACACCACGTCGACGTT

@t0000003 854045

TGAGGTAGTAGGTTGTATAGTT

@t0000004 544348

TGTGAACGGCAGACACCACGTCAGTGTT

@t0000007 286256

TGTGAACGGCAGACACCACGTCAGTGTTG

@t0000005 261735

TGTGCACGGCACACACCACGTCGACGTTT

@t0000006 174866

TGTGCACGGCACACACCACGTCGACGTTC

@t0000011 135896

GGAACACCGGGTGCAGTAGACAT

now I would like to change the title into

@t0000001_hd_2137624

@t0000002_hd_926007

@t0000003_hd_854045

...

to meet the demands of fasta file format in mirdeep2,

is there any command line or software could do this ? I searched the internet but comes no solutions.

Thank you very much. Sean

Answer 1

[GenoMax]

That format it is not fasta (it is like fastq but with the quality lines missing). If you wish it to keep in that format then you can try this:

sed 's/\ /\_hd\_/g' your_file > new_file

If you need to convert the file to fasta format at the same time then do this

sed -e 's/\ /\_hd\_/g' -e 's/^@t/>t/g' your_file > new_file

[Sean Liang]

Thanks verymuch genomax2, i followed your command but no changes happened to my file (as below), could you please help figure out the problem?

[Prasad]

it seems a tab separated headers, just replace single space to regular expression, sed -e 's/\s/\_hd\_/g' -e 's/^@t/>t/g' your_file > new_file

[Sean Liang]

It works, thank you so much Ptasad, :)

[Sean Liang]

BTW, could you pls tell me why you what the \s represents in the 's/\s/_hd_/g' command?

[Prasad]

it is representation for all type of spaces