Bowtie2 (ERR): bowtie2-align exited with value 1

Question

[s-root]

Hi

I'm fairly new to next gen sequencing data analysis and am having some issues with Bowtie2 alignment. It was working fine up until a little while ago but has been giving the following error recently: (ERR): bowtie2-align exited with value 1. I get this error if I run my bowtie2 command:

$ bowtie2 -x /path/to/genome -U /path/to/fastq |samtools view -bhS - | samtools sort - aligned_file

(followed by an Abort! )and also when I just run bowtie2 ($ bowtie2) without any parameters. Because of the latter, I thought this was an installation problem, so I re-installed the program, but it still gives me the same error. Any thoughts on what the problem is and how to fix it?

Thanks!

[jotan]

Is that the entire error message?

Answer 1

[Antonio R. Franco]

It is not only the path to the indexed genome. You need also to provide with the prefix name of that indexed genome

[longevityamit]

When I am giving this simple command

bowtie2 -c e_coli GCGTGAGCTATGAGAAAGCGCCACGCTTCC

I am getting following error

(ERR): bowtie2-align exited with value. So there is something more that I am missing.

e_coli is prefix of index files and it is in the same directory.

[GenoMax]

Use this command instead

bowtie2 -x e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC

[longevityamit]

Did not work. Now it is giving new problem:

bowtie2 -x e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC

Could not locate a Bowtie index corresponding to basename "e_coli" Error: Encountered internal Bowtie 2 exception (#1) Command: /home/amit/bin/bowtie2-align-s --wrapper basic-0 -x e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC (ERR): bowtie2-align exited with value 1

To cross check whether my directory contains e_coli prefix indexes

cat e_coli.

e_coli.1.ebwt e_coli.2.ebwt e_coli.3.ebwt e_coli.4.ebwt e_coli.rev.1.ebwt e_coli.rev.2.ebwt

1. This did not resolve the problem of (ERR): bowtie2-align exited with value 1
2. Usage of this brings new more error.

[GenoMax]

Since your local directory is not in your $PATH you need to specify

bowtie2 -x ./e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC

If you are not in the directory where the index files are then do (replace path_to with a real file path on your system)

bowtie2 -x /path_to/e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC