trim_galore finds a different adaptor than the one I expected...

Question

[blur]

Hi, I used trim galore to automatically cut adaptor sequences, and it cut the adaptor AGATCGGAAGAGC. this is the defult used by trim galore, according to the manual. But the adaptors I was told were used are TruSeq adaptors that are much longer and have a different composition...

D501–D508 Adapters

AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT

D701–D712 Adapters

GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG

so my questions are:

1. should I not have used trim galore this way (I thought it recognizes and cuts all recognized illumina sequences?). or
   1. should I also cut the TruSeq adaptors after cutting the AGATCGGAAGAGC?

thanks!

[GenoMax]

Trimming programs recognize a core sequence that is common for illumina adapters (e.g. (GATCGGAAGAGCACACGTCTGAACTCCAGTCA) for TruSeq) . If that sequence is detected then the rest of the read is generally trimmed.

[blur]

so why does trim galore indicate in the trimmimg report it cut AGATCGGAAGAGC? I checked and there was no other adaptor recognized

Answer 1

[harold.smith.tarheel]

Your trimmed sequence (AGATCGGAAGAGC) is the beginning sequence of all of your adapters (check the reverse complement of the D50x adapters to confirm). Trimming cuts the matched sequence and all trailing sequences, so it's not necessary to match each adapter individually.