alignment containing sequences from position a to b

Question

[curiousbiologist]

Hello everyone,

I'm looking for an alignment containing reads started or clipped at the first position and ended or clipped at the last position of my alignment. I don't want to have reads ended in the middle of the sequence.

For that I've done an alignment from fastq input with bwa on my entire gene, then selected a region between 2 positions (samtools view -b trialsorted.bam AA_AD:30-230 > trialsorted30-230.bam) and then realign these sequences with a reference containing only the first bases of my start position and the same for the last bases of my end position in order to keep only reads of interest. However I didn't get a selection of sequences starting from a position and ending to another position.

Does anyone have any idea how to solve my problem?

Thanks

[curiousbiologist]

java -jar picard.jar FilterSamReads I=align-sort.bam O=out.bam JS=clippFilter.js FILTER=includeJavascript

with clippFilter.js containing:

function accept(r)
 {
 return r.getContig()=="AA_AD";
 }
accept(record);

Using this command, I got something, however this one

function accept(r)
 {
 return r.getContig()=="AA_AD" &&
  r.getStart()==30 &&
  r.getEnd()==130;
 }
accept(record);

does not allow me to crop sequences from 30 to 130, nothing pass through the filter. Using igv, I saw my input contain sequences that overlap this region.

Answer 1

[Pierre Lindenbaum]

using samjs https://github.com/lindenb/jvarkit/wiki/SamJS

samtools view -b in.bam AA_AD:30-230 | java -jar dist/samjs.jar -e 'record.getContig()=="AA_AD" && record.getStart()==30 && record.getEnd()==230'

[curiousbiologist]

thank you for your rapid answer! I can't however run it with 'FilterSamReads'

[curiousbiologist]

I still don't get it, how to run this command with FilterSamReads? I tried without success:

samtools view -b in.bam AA_AD:30-230 | java -jar FilterSamReads.jar -e 'record.getContig()=="AA_AD" && record.getStart()==30 && record.getEnd()==230'

java -jar FilterSamReads.jar INPUT=in.bam -e 'record.getContig()=="AA_AD:30-230" && record.getStart()==30 && record.getEnd()==230' OUTPUT=out.bam

[Pierre Lindenbaum]

And what was the error displayed ? What did you see ?

[curiousbiologist]

ERROR: Invalid argument '-e'

impossible to find something equivalent in the options

[Pierre Lindenbaum]

"Invalid argument".

I will not give you the solution: the manual for this picard tool is here https://broadinstitute.github.io/picard/command-line-overview.html#FilterSamReads .

[Pierre Lindenbaum]

by the way, nowadays, there is no such file "FilterSamReads.jar ", there is only "picard.jar". Your version of picard looks very old. What is the version ? current is 2.7.1

[curiousbiologist]

Ok thank you! After having updated picard and carefully read of the manual, I ran this command: java -jar picard.jar FilterSamReads I="insorted.bam", O="outsorted.bam", READ_LIST_FILE="read_names.txt", FILTER="includeAligned"

with read_names.txt file containing: AA_AD:30-230 -e 'record.getContig()=="AA_AD:30-230" && record.getStart()==30 && record.getEnd()==230'

However, there is still something wrong, I don't understand what happen with insorted.bam (sorted and present in my folder): "ERROR 2016-11-22 08:54:11 FilterSamReads Failed to filter aa.bam, htsjdk.samtools.SAMException: Cannot read non-existent file: /home/admin/Bureau/insorted.bam, at htsjdk.samtools.util.IOUtil.assertFileIsReadable(IOUtil.java:338) at htsjdk.samtools.util.IOUtil.assertFileIsReadable(IOUtil.java:325) at picard.sam.FilterSamReads.doWork(FilterSamReads.java:210) at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:208) at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:95) at picard.cmdline.PicardCommandLine.main(PicardCommandLine.java:105)"

[WouterDeCoster]

The error is quite clear. The file doesn't exist in the path specified. There is no /home/admin/Bureau/insorted.bam. Where is insorted.bam?

And what's up with the comma's and "" in your command? I can't find those in the manual.

[curiousbiologist]

Thanks for opening my eyes!

[curiousbiologist]

java -jar picard.jar FilterSamReads I=insorted.bam O=outsorted.bam JS=clippFilter.js FILTER=includeJavascript

with -e 'record.getContig()=="AA_AD" && record.getStart()==30 && record.getEnd()==230' in clippFilter.js file. I however got a syntax error after the first " ' "

[Pierre Lindenbaum]

You're mixing everything. There is no such '-e' . This option '-e' is for another tool, not for picard. Your script in picard should be only:

record.getContig()=="AA_AD" && record.getStart()==30 && record.getEnd()==230

[curiousbiologist]

that's what I've finally done (and also with a script using 'function'), no problem with 'record.getContig' but when I add 'record.getStart' and/or 'record.getEnd' I get no record, as mentioned in my post above. I've tried with other files, other positions without success Here is the start of my sorted bam:

ZUXCF:05542:10628   0   AA_AD   1   34  33S62M1D5M  *   0   0   GCTTCGTAAGCTGTCAGCCTCTCACGGTCCGCTATGTTTTTCAACCCGTATCTGAGCGGCGGCGTGACCGGCGGTGCGGTCGCGGGTGGCCGGCGCAGCG    >8828<<<9=>>>===<<8<<=<<>>9==8<==>@=C>C=3=?9?A8>>=?<<<><<<78808:<===9=9::6:===:>>>666+68/:6<8<<<==<>    NM:i:1  MD:Z:62^T5  AS:i:62 XS:i:0
ZUXCF:03174:13233   16  AA_AD   1   60  68S98M  *   0   0   ATCTAGTGCTGCATGTGTATTTTCTTTGTGATTTTGCTTCGTAAGCTGTCAGCCTCTCACGGTCCGCTATGTTTTTCAACCCGTATCTGAGCGGCGGTGTGACCGGCGGTGCGGTCGCGGGTGGCCGGCGTCAGCGTTCGCAGCCCGGCTCCGCGCAGGGCTCGGG  0)++++..,,-..<<<:::4=<<;6;;8887)7777;7=<<<8>==;;::770788<<883=<7<;;8888)888886;3;;;@====<7777770::;;;94<7994=</0,><99;6<<<77282<<<;;;;880888;;;7==9=<=9<<<:;82::<0/.?A  NM:i:1  MD:Z:29C68  AS:i:93 XS:i:0

[Pierre Lindenbaum]

so you don't have any read starting at 30...

[curiousbiologist]

it's only the beginning of the file... My aim is not to select reads starting at a defined position and ending at a defined position but get an interval of sequences between two positions even if I have piece of reads

[vmicrobio]

You may find a way to trim the aligned sequence at position 30, then do the same with 230 and remove all the part-aligned sequences using FilterSamReads record.getStart()==30 && record.getEnd()==230

[curiousbiologist]

how can I trim aligned sequences at position 30 and 230?