Illumina Miseq fastq file, barcode or no barcode? for Qiime Processing

Question

[nidhiv]

Hello

The following is the head for one of my paired fastq file:

@HWI-M04771:60:000000000-AURUP:1:1101:15803:1815 1:N:0:TGAGGTTTGATG
TACGGGGGATGCAAGCGTTATCCGGAATCATTGGGCGTAAAGCGCCTGTAGGTTGTTTAGTAAGTCCATTGTTAAAGACCAGGGCTTAACCCTGGGAAAGCAATAGAAACTACTAGACTTGAGTATGGCAGGGGTAGAGGGAATTTCTAGTGTAGCGGTGAAATGCGTAGATATTAGAAAGAACACCGGTGGCGAAAGCGCTCTACTGGACCATTACTGACACTGAGAGGCGAAAGCTAGGGTAGCAAAAGGG
+
BBBBBBFBBBFFEGGCEFGAGAGGGFFF3CAGFGGGHHGGFHFACEEGGGGGEGFEGFHDGHHGHFF<BGHGHHHH>BCCGCCHHFFGGFEEGFC2HGDFEG3FDGG@FGGDGGHFGFGDHHGHFDF?<GHFFHFGFFFDHHGHHHHHGCGHHHGHHHGHHHEGE=DFHHHHHHHHHHHHHEE0EFEAA@DEEHFECEFA?ADBHGGGGGB;BFFHGFEFGFHHGHEEECGGGGGGFFGGGFFFFFFFB>3>>

Since the index sequence is present in the first line, does that imply I need to process it and match it with a separate barcode fastq file using split_libraries_fast.py. I haven't received a barcode file as such from the sequencing lab and want confirm if I need to have that.

Do I have to include it in my mapping file?

Any help is appreciated a lot!

Thanks!

[WouterDeCoster]

I'm not familiar with Qiime, but this looks like the run has been demultiplexed (split into barcodes) and the barcodes have been clipped.

[GenoMax]

These samples are already demultiplexed. See the section on "working with already demultiplexed files" in this QIIME tutorial.