hai frds,
I am using the DBsnp database how to find the literature paper?
Filters activated: Homo sapiens, missense. Clear all to show 12252 items.
Select item 28933990 1.
rs28933990 [Homo sapiens]
GTCACCGCAGGATTCCTTCCCAGCC[C/T]GGTTCAAAGCCATCCACTTCATCCA
Chromosome: 15:89210794 Gene: RLBP1 (GeneView) Functional Consequence: missense Allele Origin: T(germline)/C(germline) Clinical significance: Pathogenic Validated: by cluster,by frequency HGVS: NC_000015.10:g.89210794G>A, NC_000015.9:g.89754025G>A, NG_008116.1:g.15898C>T, NM_000326.4:c.700C>T, NP_000317.1:p.Arg234Trp, XM_011521870.2:c.700C>T, XM_017022460.1:c.727C>T, XP_011520172.1:p.Arg234Trp, XP_016877949.1:p.Arg243Trp
VarviewProtein3D Select item 28933989 2.
rs28933989 has merged into rs137853290 [Homo sapiens]
GGCTACCCTGGTGTCCTCTCTAGTC[A/C/G]GGACAAGTATGGCCGAGTGGTCATG
Chromosome: 15:89215133 Gene: RLBP1 (GeneView) Functional Consequence: missense Allele Origin: G(germline)/A(germline) Clinical significance: Pathogenic Validated: by cluster,by frequency HGVS: NC_000015.10:g.89215133C>G, NC_000015.10:g.89215133C>T, NC_000015.9:g.89758364C>G, NC_000015.9:g.89758364C>T, NG_008116.1:g.11559G>A, NG_008116.1:g.11559G>C, NM_000326.4:c.452G>A, NM_000326.4:c.452G>C, NP_000317.1:p.Arg151Gln, NP_000317.1:p.Arg151Pro, XM_011521870.2:c.452G>A, XM_011521870.2:c.452G>C, XM_017022460.1:c.479G>A, XM_017022460.1:c.479G>C, XP_011520172.1:p.Arg151Gln, XP_011520172.1:p.Arg151Pro, XP_016877949.1:p.Arg160Gln, XP_016877949.1:p.Arg160Pro
VarviewProtein3D
See this links, they look helpful:
http://www.internationalgenome.org/category/dbsnp
Find dbSNP below as well:
http://pga.gs.washington.edu/presentations/db_interface_tutorial.pdf
The third link is for literature search:
https://www.ncbi.nlm.nih.gov/books/NBK44420/
I wouldn't expect that every dbSNP entry has a linked article, probably a lot of the data in there is just deposited.
hai frd,
RLBP1 gene in mutation (missense mutation) and not for the link . only shown as in Varview Protein3D . i have need for in PubMed .https://www.ncbi.nlm.nih.gov/snp/?term=(RLBP1+) see this link
Please rephrase, that sentence doesn't make sense to me.