Retrieving nucleotide sequence based on chromosome location offline

Question

[Mask]

I have downloaded whole genome file from this link (ftp://ftp.broadinstitute.org/pub/genepattern/rna_seq/whole_genomes/Homo_sapiens_UCSC_hg19.fa). Now I need a program in Perl or Python to retrive nucleotide (user defined position) sequnce from the whole genome. I need to perform this offline The user input can be 1. Enter the chromosome number 2. Enter start position 3.Enter end position

The genome file i downloaded looks like

chrM

GATCGGTCTGACGTGCTgaTGATGATA GATCGGTCTGACGTGCTGATGATGATA

chr1

NNNNNNNNNNNNNNNNNNNNNNNNNNtggGGAATTttaag

Answer 1

[Alex Reynolds]

You can simply use samtools to index the FASTA file, and then query the indexed FASTA file with your interval of interest.

1. Generate the index: samtools faidx in.fasta
2. Query via: samtools faidx in.fasta chrN:X-Y

Replace chrN:X-Y with the chromosome name (chrN), start position (X) and stop position (Y) of interest.

Answer 2

[Asaf]

Look at the Biopython cookbook. Especially Sections 2.4 and 3.3

Answer 3

[gangireddy]

look at 3rd answer here