local blast: makeblastdb: Abort trap 6

Question

[rororo]

I am running a standalone Blast 2.6.0 on my Mac OS 10.12.2 with 1.6 Ghz intel core i5 8 GB 1600 MHz DDR3.

Everytime when I want to build a blast database with the makeblastdb command, I get the following error:

Building a new DB, current time: 01/24/2017 09:13:26 New DB name: /Users/*/bin/blast/blastdb/Cat2.fasta New DB title: Cat2.fasta Sequence type: Nucleotide Keep MBits: T Maximum file size: 1000000000B Abort trap: 6

What can I do? My file is 3.4Mb big.

I appreciate your help!

[Buffo]

Can you post your command?

[rororo]

makeblastdb -in Cat19_prot.fasta -parse_seqids -dbtype prot

[GenoMax]

Please use ADD COMMENT/ADD REPLY when responding to existing posts to keep threads logically organized.

[Buffo]

Try this:

formatdb -i Cat19_prot.fasta -o T -p T

it produces 6 indexes, then;

blastp -query your_query.faa -db Cat19_prot.fasta -evalue 1e-5.... etc etc etc...

[rororo]

next problem: formatdb command is not found...

[GenoMax]

makeblastdb is the correct command for blast+.

[rororo]

I found out that formatdb is superseded by the makeblastdb command

[Matteo Schiavinato]

Giving it a quick google, I found that such error can only be the cause of some mishandling in C++ code. Therefore, I think there might be something wrong in your input fasta file. How did you generate it?

[rororo]

I had an excel sheet with 3 columns: consecutive number, name of gene, sequence therefore I copied everything into a text editor and replaced all tabs with underscore, all slashes/colons with underscore etc and added a bigger than sign to the beginning, so this:

>1.gene
atgttgcaagagaaagtaaagccaatagaagaaacactcgaccccgaggattgggaatccatgcgggcactcggtcatcggatggttgacgacatgttaacatacctacggaatgtacgatccgaaccatcaggttctcccacccaaaaagccatcgaggatatttgcgttcctcttacacacgacggggaaggcgaagagaaagtttacgaggtattccaacatagtattctcccttatacgttttcaatcacgaggcctcggttttggggactagttgccggaaccggctccccatatgggatgttcgctgagatgctaagagcgggtatgaacagttgccaagaaagccttttcgcagaagcatatgtccacaagcaggtaatcggctggattaaggagatggtcgacttccccgaagaggctggcggagtactcgtaagcggtggctcagaggctaatttcaccggattagccgttgctcgaaataca

so it should be formatted as a fasta file

I also performed all search+replace commands with two other files of the same structure and there were no problems with the makeblastdb command

[GenoMax]

I have formatted your code correctly. In future use the icon shown below (after highlighting the text you want to format as code) when editing (Screenshot courtsey of @Wouter).

[Matteo Schiavinato]

I have two concerns:

• are you sure that what you copied from excel to a data sheet is unformatted text, without any rich text markup anywhere?
• Did you try using uppercase sequence letters?

[rororo]

yes it is unformatted text, also when I display invisible characters, the only invisible character is the new line feed. I did not try uppercase, because makeblastdb with lowercase letters has already worked

---edit--- I found out that I only get that Abort trap: 6 error when I add the flag -parse_seqids