Receiving an error when using blastn remotely within a loop. "service not found" "null_connector" "Cannot read header" "Unable to read data" and "Failed to flush"

Question

[Jacob]

I"m receiving the errors below when running this script. I don't know what the errors mean or how to fix them. Is it possible I was blocked from the blast server?

Script I'm running

for org in "Homo sapiens" "Mus musculus" ... ...
do
        for gene in Acan ... ... ...
        do
        blastn -query geneFiles/$Gene -db refseq_genomic -out "outputfile" -evalue 0.00001 -outfmt 6 -entrez_query "${org}[Orgnanism] AND refseq[filter]" -remote
        done
done

geneFiles/Acan (Example of one of the files I'm passing to the script

>NM_013227.3 Homo sapiens aggrecan (ACAN), transcript variant 2, mRNA
CACCTACCTCCCCGCCGCTCCAGAGGGGGCTCGCAGAGCTGAGGACGCGCGCAGCGCTGCTCAAGGTCTC
...

Errors (Repeats over and over)

Error: (308.5) [blastn] [blast4]  Service not found
Error: (315.2) [blastn] CConn_Streambuf::CConn_Streambuf():  NULL connector: Unknown
Error: (802.5) [blastn] CObjectOStream: error at byte 93: stack is empty: write fault
Warning: (307.8) [blastn] [HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0]  Cannot read header (Timeout)
Error: (301.23) [blastn] [CONN_Read(blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0)]  Unable to read data: Timeout[30.000000]
Error: (315.8) [blastn] CConn_Streambuf::underflow():  CONN_Read() failed (blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0): Timeout
Warning: (301.21) [blastn] [CONN_Flush(blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0)]  Failed to flush: Closed
Error: (315.9) [blastn] CConn_Streambuf::overflow():  CONN_Flush() failed (blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0): Closed

[GenoMax]

Consider changing to a short/informative title for your post. Using an error message as is, is never informative.

[Jacob]

What would you recommend, I don't know what else to post because all I know is that this error is happening

[GenoMax]

How about "Error(s) with remote blast".

Did you verify with one or two sequences that the searches were working before using the full scale double loop?

[GenoMax]

Are you behind a proxy/firewall? Are you using the latest blast+ executables? You should also limit remote blast calls to a certain number per unit time otherwise your IP may be blacklisted by NCBI.

[Jacob]

I haven't had firewall problems with previous blast commands I've executed, but I'm not sure if I'm behind one.

I just downloaded blast+ last week so I am probably on the latest.

I put in a sleep command into my loop but I might already be blacklisted. Is there a way I can fix that?

[GenoMax]

If your IP is black listed (run a single search to see if it goes through to check) then wait a day or so until the block ages out. Put in a longer delay between your jobs/run smaller batches at one time.