entrez utilities: snp

Question

[DanielC]

Dear All,

I am trying to get the 3' and 5' UTR of the BRCA1 and BRCA2 mRNA. I came to know about entrez utilities to do it like this:

source: https://www.ncbi.nlm.nih.gov/books/NBK179288/

and the code is:

ThreePrimeUTRs() {
    xtract -pattern INSDSeq -ACC INSDSeq_accession-version -SEQ INSDSeq_sequence \
      -group INSDFeature -if INSDFeature_key -equals CDS -PRD "(-)" \
        -block INSDQualifier -if INSDQualifier_name \
          -equals product -PRD INSDQualifier_value \
        -block INSDFeature -pfc "\n" -element "&ACC" -rst \
          -last INSDInterval_to -element "&SEQ" "&PRD" |
    while read acc pos seq prd
    do
      if [ $pos -lt ${#seq} ]
      then
        echo -e ">$acc 3'UTR: $((pos+1))..${#seq} $prd"
        echo "${seq:$pos}" | fold -w 50
      elif [ $pos -ge ${#seq} ]
      then
        echo -e ">$acc NO 3'UTR"
      fi
    done
  }

  esearch -db nuccore -query "3.6.4.12 [ECNO]" |
  efilter -molecule mrna -source refseq |
  efetch -format gbc | ThreePrimeUTRs

When I run this I keep getting error saying;

**Unrecognized argument '-if'
No -element before 'INSDFeature_key'
Unrecognized argument '-equals'
No -element before 'CDS'**

Can someone please help me know what is going wrong? And, can I get the 5' UTR following the same code? And, finally, I also want to get the SNPs in the 3' and 5' UTR?

Thank you so much! DK

[GenoMax]

If you put the code in a file, make it executable and run it, it produces a result.

>XM_005708748.1 3'UTR: 1918..1941 ATP-dependent DNA helicase RecQ
gtgtggttttcaacaagttttaca
>XM_005707168.1 3'UTR: 3700..3734 ATP-dependent DNA helicase RecQ
gttgctttgggtttcacaaggtaaatttatgacaa
>XM_005706277.1 3'UTR: 1799..1836 ATP-dependent DNA helicase 2 subunit 1 isoform 1
gaacggccagtatacaacacccagatcagccaaatcaa
>XM_005706276.1 3'UTR: 1409..1481 ATP-dependent DNA helicase 2 subunit 1 isoform 2
tccgtcaaaatattcggatcctgatattcaacgatattataacggattac
aagctctggctctgaatcaaacc
>XM_005705233.1 3'UTR: 1632..1709 ATP-dependent DNA helicase RecQ
ctttattgtatgagaattttctgaatttctttgcagacatttctttcgca
tgtatcttataaacaactataagattgt
>NM_001278454.1 3'UTR: 6111..8976 chromodomain-helicase-DNA-binding protein 2
agcgactgagaaggggggggggaaacacgtcttgaaagacttggatgcaa
caaccagaaactctgaacatgctgctatcatcttgctgggtcaaggagga
ttttggaggagcaggtggaggaagactcagttctaatttgggttcccatt
ttgtttccccccctttctctcgttgaacattggaaccagacttgcctcgt
tctttttctttggtttgttttccccaatccaacggacacgtggagaattt
tcctcagccacagtgtttccccaaaaccgagaaggcggatcaatgctgct

truncated for brevity.

You will need to change your query (e.g. -query "BRCA") to get what you need.

[DanielC]

Thanks! but when I run I keep getting this error above

Unrecognized argument '-if' No -element before 'INSDFeature_key' Unrecognized argument '-equals' No -element before 'CDS'*

[GenoMax]

Are you using the bash shell? If not, issue the command bash and then run the file at the new system prompt that should show up.

[DanielC]

OK, Thanks. I will try and update here.

[Sej Modha]

Isn't this question same as SNPs; entrez utilities ?

[DanielC]

Not exactly, because in that I had no idea of the approach. Here, I have found a way, but having errors and missing features to get the SNPs.

[DCGenomics]

I have it on good information that if you update your implementation of eutils, this should work fine.

Answer 1

[Pierre Lindenbaum]

using XSLT , assuming it's mRNA, 5'->3', with the correct annotation. I'm extracting the position of the left and right CDS:

[DanielC]

Hi Pierre, thank you so much! This xlst seems like a promising tool. Please help me understand a few queries:

a) "using XSLT , assuming it's mRNA, 5'->3', with the correct annotation. I'm extracting the position of the left and right CDS:"

I have never actually given thought to, whether mRNA 5' -> 3' or vice versa. I thought the file from which the UTRs are to be extracted are well annotated with all necessary information. Do I need to be careful when extracting such info from entrez?

b) I ran your script and it worked like charm, however, could you please help me understand briefly what is the script "transform.xls" doing? It will help me to have a clear idea.

c) Please let me know how you got the refseqids for this search here:

$ wget -q -O - "https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=`NM_007299.3`&id=**NR_027676.1**&id=**NM_007299.3**&id=`NM_007298.3`&retmode=xml" | xsltproc --novalid transform.xsl - | fold -w 60

d) After I have got the 5' and 3' UTRs, I need to extract the SNPs and their positions,could you please share how this could be done using xslt?

Thanks much!

[Pierre Lindenbaum]

a)

I thought the file from which the UTRs are to be extracted are well annotated

they're not: there is no CDS in NR_027676.1

b) I'm going to add some comment, please update in a few minutes

c) how you got the refseqids

i've just peeked a few randow mRNA accessions using entrez "mRNA BRCA1"

d) no, because that's not your original question. Ask a new question.

[DanielC]

Ok, thanks for the explanation. For the SNPs in 3' and 5' UTRs and their positions, I have asked a new question, please share the solution. Thank you :-)

SNPs in UTR