general question about strand D and R

Question

[rob.costa1234]

I have a very simple question- if after genomics coordinate letter D and R mentioned, that means D is forward strand, R is reverse strand? AM I correct?

Thanks

[Devon Ryan]

Can you give an example where this nomenclature is used?

[rob.costa1234]

If I quary Myc to etract upstream/ downstream -2000 bp sequence in RSAT (http://rsat.sb-roscoff.fr/retrieve-ensembl-seq_form.cgi) the first few lines are:

 >Homo_sapiens-ENSG00000136997-MYC-ENST00000259523  ENSG00000136997-ENST00000259523; upstream from -2000 to -1; size: 2000; location: chromosome:GRCh38:8:1:145138636:1 127733434 127735433 D
AAATTAACCGGGTGTGGTGGTGCACTGCACTCCCAGCTACTGGGCTGGGGTATCAGGCTG

It has D in the end

[Devon Ryan]

For such random tools like that you'll have to ask the author. My guess is that it only means something in French.

[glihm]

I confirm, in french some people use D and R for "Direct" (Forward) and "Reverse" respectively.

Answer 1

[glihm]

To give the answer accordingly to the original question:

Yes, the french original notation is Direct and Inverse. But Inverse is often named Reverse (Anglicism). So D and R can be found as D and I. But most of time people are using +/-, D/R and F/R.

Indomitable Gauls still hold out against full english! Ahahah