RATT annotation transfer tool usage.

Question

[Mehmet]

Dear all,

First of all this is not a question. I have tried to run RATT tool over a week, and finally I managed to run and received results. I am writing here that If anyone needs help about usage of RATT from generating embl file of each scaffold in an assembly to installation of RATT and usage, I can help.

I would like to thank Alex Reynolds, cpad0112 and Juke-34 for their help.

[WouterDeCoster]

Perhaps most useful would be to write a tutorial on how to use it - and post that here as a tutorial.

[Ace]

A tutorial would be fantastic. I'm struggling with this program, currently.

[Mehmet]

OK. I will do as soon as possible.

[Mehmet]

Please let me know where you are having problems while you are running RATT.

[Maksim Nesterenko]

Dear Mehmet, Could you tell us, have you finished manual for RATT? Unfortunately, i have some problems with RATT usage. Thanks

[GenoMax]

RATT documentation is available. Does it not help?

[Mehmet]

Sorry for being late. Could you please let me know at which point you need help? At least I can do this until I complete tutorial.

[peri.tobias]

Hello Mehmet, I am late to this thread, but would appreciate some guidance please if you are able to help. I have spent the whole day trying to get this software running after installing PAGIT locally and also using EMBLmyGFF3 to build .embl from augustus output. I try to run this script:

start.ratt.sh ./EMBL query.fa MR_H Assembly reference.fa

and get this error, which is a listed warning in the RATT documentation.

I am using the reference.fa. Please make sure that the description line of each fasta entry is the same than in the embl file name!

I believe that my files comply. Here is an example of the head of my .embl

XXX; XXX; linear; genomic DNA; XXX; XXX; 124273364 BP.

XX

AC XXX;

XX

AC * _APSI_P001

XX

PR Project:PRJEB1234;

XX

and the fasta

APSI_P001 ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCAATGTAATCTATATGAAAA ATTAGATTTTTAATGAATTTTATAATATATCTCATATGAAAAAACTTTCACAATGTAATTCAATGAAAAA AATATTTTTCAATACAATTCATATTGAAAATACGTATTTTTAGTGTAGTTTATATTGAAACTGCATTTTC

Many thanks in advance of your anticipated help.

[Mehmet]

Hi Peri,

Sorry for my late reply. Can you try this?

  ./start.ratt.sh embl_files_directory/ New.genome.fa old2new Assembly