My output of variant calling is different by samtools and platypus

Question

[Anop Singh Ranawat]

samtools command

samtools mpileup -u -f /usr/lib/cgi-bin/GenomaticMYELOID/ReferenceGenome/hg19/hg19.fa /home/anopperl6/Exomesoft/bam/sample_sort.bam | bcftools call -vmO z -o - > outputstudy.vcf.gz

Platypus command

python Platypus.py callVariants --bamFiles=/home/anopperl6/Exomesoft/bam/sample_sort.bam --output=/home/anopperl6/Exomesoft/bam/sample_sort.vcf --refFile=/usr/lib/cgi-bin/GenomaticMYELOID/ReferenceGenome/hg19/hg19.fa --logFileName=log_platypus --nCPU=4 --minFlank=0 --filterDuplicates=0 --maxVariants=20

[WouterDeCoster]

I don't think this is a software error. This is exactly as expected. It would be a miracle if two variant calling tools presumably using a different algorithm produce exactly the same result.

[Anop Singh Ranawat]

platypus can call this variant :

chr11   32417945    .   T   C   2962    alleleBias  BRF=0.0;FR=0.5000;HP=1;HapScore=1;MGOF=18;MMLQ=38;MQ=60.0;NF=0;NR=746;PP=2962;QD=20;SC=CAGGCACACGTCGCACATCCT;SbPval=1.0;Source=Platypus;TC=5671;TCF=0;TCR=5671;TR=746;WE=32417953;WS=32417886   GT:GL:GOF:GQ:NR:NV  1/0:-298.01,0.0,-297.19:18:99:5671:746

but samtools can't

why ?

[Pierre Lindenbaum]

the variant in platypus is already 'bad' anyway because platypus set the FILTER : alleleBias

[Anop Singh Ranawat]

thanks Pierre Lindenbaum and WouterDeCoster,

so what you mean by bad variant ? could you explain ?

GATK also call this variant.

chr11 32417945 0 T C 11998.81 LowVariantFreq BaseQRankSum=7.009;DP=4998;DS;Dels=0.00;FS=0.000;HRun=1;HaplotypeScore=309.8281;MQ=50;MQ0=0;MQRankSum=0.371;QD=2.40;ReadPosRankSum=-1.931;SB=-0.01 GT:AD:DP:GQ:PL:MQ:GQX:VF 0/1:4317,669:4998:99:11999,0,159236:50:99:0.134

[Pierre Lindenbaum]

the variant was FILTERED (==use with caution) with alleleBias (7th column). I don't know the platypus fields but it should be declared in the VCF header...

##FILTER=<ID=alleleBias,Description="????">

Same for your second example: its a FILTERED with LowVariantFreq

[Anop Singh Ranawat]

Thank you so much Pierre Lindenbaum

[Anop Singh Ranawat]

thanks Pierre Lindenbaum,

i have one problem regarding above discussion , i have been finding somatic variant(AML) with single bam file. but alleleBias or LowVariantFreq variant can be present in finding somatic variant in vcf file.

so how to find somatic variant with single bam file by samtools ?

thanks in advance

[Kevin Blighe]

Next generation sequencing data is full of error and variant callers, thus, rarely agree.

If you want to try to call this variant with SAMtools/BCFtools, try -c / --consensus-caller and -m, --multiallelic-caller separately with your BCFtools call command.

You can also try modifying

-p, --pval-threshold <float>    variant if P(ref|D)<FLOAT with -c [0.5]