fastq quality scores

Question

[nukkduko]

Hello everyone! I'm a little bit confused with fastq quality score. I've got fastq with reads like this:

@EAS18:1:1:2:1642:1830:0/2
TGTCCCATCTCATGCTCAAGCAGCAGACGAAC
+
a`_^a_^a_aa^aa`a_`_a[[a^_aU__W^^Xa````^_`RER

What is phred quality score for first nucleotide? It's "a", but there is no small "a" in The Table:

All that I know is that this score must be less or equal than 40.

Answer 1

[cschu181]

You're looking at a Phred33 table, but your read looks as if it might have a different encoding (Phred64): https://en.wikipedia.org/wiki/FASTQ_format.

[nukkduko]

Yes, thanks for your help. With that table it works: