Samtools faidx non-zero exit status 217

Question

[L. A. Liggett]

I have been using something like samtools faidx hg19.fa chr1:115227843-115227863 to extract sequence for specified locations. However, for the particular command above I am getting: Command 'samtools faidx hg19.fa chr1:115227843-115227863' returned non-zero exit status 127. Am I doing something wrong here?

[FatihSarigol]

Just wondering, does samtools itself work when you type samtools? As the manual says, "if a command is not found, the child process created to execute it returns a status of 127" GNU

[L. A. Liggett]

Yeah samtools does appear to be working fine. I'll try building a new reference and see if this helps.

[h.mon]

Maybe your index or fasta are corrupted? Which version of samtools? With samtools 1.3.1:

samtools faidx hg19.fa chr1:115227843-115227863

>chr1:115227843-115227863

TGCTTCCCTGCTTCCAATGGC