[Errno 8] Exec Format Error Using Tophat 1.3.1

Question

[Marina Manrique]

Hi all,

I've installed Tophat 1.3.1 following these instructions

and when I run the test command to know if the installation has gone OK

sudo tophat -r 20 test_ref reads_1.fq reads_2.fq

I get this error message

[Errno 8] Exec format error

Here you have the complete log

[Sun Jul 24 13:48:10 2011] Beginning TopHat run (v1.3.1)
-----------------------------------------------
[Sun Jul 24 13:48:10 2011] Preparing output location ./tophat_out/
[Sun Jul 24 13:48:10 2011] Checking for Bowtie index files
[Sun Jul 24 13:48:10 2011] Checking for reference FASTA file
[Sun Jul 24 13:48:10 2011] Checking for Bowtie
        Bowtie version:                  0.12.7.0
[Sun Jul 24 13:48:10 2011] Checking for Samtools
        Samtools Version: 0.1.17
[Sun Jul 24 13:48:10 2011] Generating SAM header for test_ref
[Sun Jul 24 13:48:10 2011] Preparing reads
        format:          fastq
        quality scale:   phred33 (default)
        [FAILED]
[Errno 8] Exec format error

I've checked that Samtools, Bowtie and Tophat and they seem to be correctly installed,

Anyone knows what would be the problem? The only kind of TopHat errors I've found reported so far are I/O errors and this doesn't seem to be such kind of error.

Thanks!

[Gww]

What do your fastq (.fq) files look like?

[Marina Manrique]

It's the dataset to test tophat, I took it here

http://tophat.cbcb.umd.edu/downloads/test_data.tar.gz

Anyway here you have two reads

@test_mRNA_150_290_0/1 TCCTAAAAAGTCCGCCTCGGTCTCAGTCTCAAGTAGAAAAAGTCCCGTTGGCGATCCGTCTACGTCCGAGTAAGA + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII @test_mRNA_8_197_1/1 TCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGACACTACGGGGATGGCGACTAGGACTACGGACGG + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

Answer 1

[Marina Manrique]

I was 'just' using the MacOS version (on a Linux 64 machine)... so stupid...

[zhangpeng1334880]

Please help me .I got the same error.But the problem still exist when I use the linux version!