Hisat2 build index error

Question

[hsu]

Hello, I downloaded Saccharomyces reference genome from SGD, the latset version. And then I used hisat2-build to build index, code as :

hisat2-build --wrapper basic-0 S288C_reference_genome_R64-2-1_20150113.fa ./INDEX

But there is always this mistake:

Reference file does not seem to be a FASTA file
  Time to join reference sequences: 00:00:00
Total time for call to driver() for forward index: 00:00:01
Error: Encountered internal HISAT2 exception (#1)

Command: hisat2-build --wrapper basic-0 S288C_reference_genome_R64-2-1_20150113.fa ./INDEX Deleting "./INDEX.1.ht2" file written during aborted indexing attempt. Deleting "./INDEX.2.ht2" file written during aborted indexing attempt. Deleting "./INDEX.3.ht2" file written during aborted indexing attempt. Deleting "./INDEX.4.ht2" file written during aborted indexing attempt. Deleting "./INDEX.5.ht2" file written during aborted indexing attempt. Deleting "./INDEX.6.ht2" file written during aborted indexing attempt. Deleting "./INDEX.7.ht2" file written during aborted indexing attempt. Deleting "./INDEX.8.ht2" file written during aborted indexing attempt.

what should I do about it?

thanks for your answer.

[GenoMax]

Why are you adding the --wrapper (or if that is not your original command then please provide that instead)? A simple

hisat2-build -f S288C_reference_genome_R64-2-1_20150113.fa S288C

should be enough.

[hsu]

still the same error

[GenoMax]

What do the following two commands print?

head -4 S288C_reference_genome_R64-2-1_20150113.fa and grep ">" S288C_reference_genome_R64-2-1_20150113.fa?

[hsu]

Settings:

 Output files: "./INDEX.*.ht2"
  Line rate: 6 (line is 64 bytes)
  Lines per side: 1 (side is 64 bytes)
  Offset rate: 4 (one in 16)
  FTable chars: 10
  Strings: unpacked
  Local offset rate: 3 (one in 8)
  Local fTable chars: 6
  Local sequence length: 57344
  Local sequence overlap between two consecutive indexes: 1024
  Endianness: little
  Actual local endianness: little
  Sanity checking: disabled
  Assertions: disabled
  Random seed: 0
  Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
  S288C_reference_genome_R64-2-1_20150113.fa
Reading reference sizes
Warning: Encountered reference sequence with only gaps
  Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
Reference file does not seem to be a FASTA file
  Time to join reference sequences: 00:00:00
Total time for call to driver() for forward index: 00:00:01
Error: Encountered internal HISAT2 exception (#1)
Command: hisat2-build --wrapper basic-0 -f S288C_reference_genome_R64-2-1_20150113.fa ./INDEX
Deleting "./INDEX.1.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.2.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.3.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.4.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.5.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.6.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.7.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.8.ht2" file written during aborted indexing attempt.

[GenoMax]

This is NOT the output of the two commands I had asked you to provide output of.

[hsu]

There aren't the two commands print that you asked.

[GenoMax]

If the head and grep command are not printing any useful output then there is something wrong with your fasta format sequence file. What does file S288C_reference_genome_R64-2-1_20150113.fa show? If it does not show ASCII text you may have a corrupt sequence file, which you will need to re-download.

[hsu]

These are two commands outputs:

 S288C_reference_genome_R64-2-1_20150113/0000775000554500003120000000000012463257272016120 5ustar  shuaishuaiS288C_reference_genome_R64-2-1_20150113/rna_coding_R64-2-1_20150113.fasta0000664000554500003120000054452712455312025023155 0ustar  shuaishuai>HRA1 HRA1 SGDID:S000119380, Chr I from 99305-99868, Genome Release 64-2-1, ncRNA_gene, "Non-protein-coding RNA; substrate of RNase P, possibly involved in rRNA processing, specifically maturation of 20S precursor into the mature 18S rRNA"

GGGCCCTTTCT`enter code here`TCCGTTTGAACGTAAAGGCATTTTTGAGACCATTACCAAACCTAGCAAA
TAAACCGGGAGGCTTGACTGCTCGTAGGGATTGTGGTTGATATGCATCTGAGTCGAATCT
ATTGGCATTCCAAGACGTTTGGTCGTCATGGTTATTGCTCATAAATAGATTTTCATGGAC

Binary file S288C_reference_genome_R64-2-1_20150113.fa matches

[GenoMax]

Looks like your fasta sequence file is corrupt. You will need to re-download the file. It should be plain text in right format.

[hsu]

ok, thank you.

I re-download the reference genome several times. But still the same error.

wuwuwu....

[GenoMax]

Where and how are you downloading the reference from?

If that is not working then you could download pre-made indexes from iGenomes site. That includes sequence/annotation/indexes everything.

[hsu]

Command:

hisat2-build --wrapper basic-0 --wrapper basic-0 S288C_reference_genome_R64-2-1_20150113.fa ./INDEX
Deleting "./INDEX.1.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.2.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.3.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.4.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.5.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.6.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.7.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.8.ht2" file written during aborted indexing attempt.

[GenoMax]

Please edit your original question or use ADD REPLY/ADD COMMENT when providing additional information. SUBMIT ANSWER should only be used for providing new answers for original question.