Problems running Trinity 2.6.6.

Question

[Guillermo D. Huerta]

Hi all,

I'm trying to run Trinity (2.6.6.) to analyze a metatranscriptome, but it is giving me the following errors:

Error, pairs.K25.stats is empty.  Be sure to check your fastq reads and ensure that the read names are identical except for the /1 or /2 designation. at /fs/project/PAS1117/modules/trinity/2.6.6/util/insilico_read_normalization.pl line 921.
CMD finished (1209 seconds)
Error, cmd: /fs/project/PAS1117/modules/trinity/2.6.6/util/insilico_read_normalization.pl --seqType fq --JM 112G  --max_cov 50 --min_cov 1 --CPU 28 --output /fs/project/PAS1117/GuiDH/Trinity_tests/trinity_out_dir/insilico_read_normalization   --max_pct_stdev 10000  --left /fs/project/PAS1117/Tara_Euk/upwelling-v2/ERR1719296_1.fastq.gz --right /fs/project/PAS1117/Tara_Euk/upwelling-v2/ERR1719296_2.fastq.gz --pairs_together --PARALLEL_STATS   **died with ret 512 at /fs/project/PAS1117/modules/trinity/2.6.6/Trinity line 2581.
        main::process_cmd('/fs/project/PAS1117/modules/trinity/2.6.6/util/insilico_read_...') called at /fs/project/PAS1117/modules/trinity/2.6.6/Trinity line 3127
        main::normalize('/fs/project/PAS1117/GuiDH/Trinity_tests/trinity_out_dir/insil...', 50, 'ARRAY(0x2735d58)', 'ARRAY(0x277bb80)') called at /fs/project/PAS1117/modules/trinity/2.6.6/Trinity line 3074

Could someone check if there is something wrong with the batch file sent? (pasted here below)

#PBS -N trinity_test3
#PBS -l walltime=40:00:00
#PBS -l nodes=1:ppn=48
#PBS -j oe
#PBS -m abe
#PBS -A PAA0034
set -x
cd $PBS_O_WORKDIR
module use /fs/project/PAS1117/modulefiles
module load samtools/1.3.1
module load bowtie2/2.2.9
module load jellyfish/2.2.9
module load salmon/0.9.1
module load trinity/2.6.6
Trinity --seqType fq --left /fs/project/PAS1117/Tara_Euk/upwelling-v2/ERR1719296_1.fastq.gz --right /fs/project/PAS1117/Tara_Euk/upwelling-v2/ERR1719296_2.fastq.gz --CPU 28 --max_memory 112G
echo $PBS_JOBID
echo $PBS-JOBNAME

Thank you!

[h.mon]

Maybe a problem with fastq headers: Trinity v2.4.0 error ret 512 at ./Trinity line 2462. See also

How do I use reads I downloaded from SRA?

Another debbuging hint: Error, pairs.K25.stats is empty;

[Guillermo D. Huerta]

Hi,

thanks very much for your answer!

If you have a look to the top lines of the (right) fastq.gz file, would you say that is a matter of format?

@H10C:D1D8LACXX:2:1101:1390:2131_F/1
CTTTCGTACTAAAAACAATAAATCTCACTCTATAAGATAGAAACCAATCTAGCTTTCGCCGATCTGAACTCAAATCATGTAAAAATTTAAAA
+ERR1719154.1.1 H10C:D1D8LACXX:2:1101:1390:2131 length=92
ABD>D?CFBF<FAAEFIEIEFIA9CHG9CC@EGFDF@?C?BFDF;?;B??BF4//=8-7@;@<EBB))76;A@CACB>A5(5;B39>5;>BA
@H10C:D1D8LACXX:2:1101:1269:2133_F/1
GACAGAAGGAGGTTCAATGTACCAGGAAGCCTANG
+ERR1719154.2.1 H10C:D1D8LACXX:2:1101:1269:2133 length=35
=ABDDDFFBCDF<E<FFEHHEFIF>GEFEGFIF#0
@H10C:D1D8LACXX:2:1101:1411:2137_F/1
TGCTAATTTACTAGGATTGCAATGACTAGTAAGAACGTGTCATCATCAGGACAGCAATCCCCGTCACGGCAAAAAGCAATGGAAATTGGTTCAAAAAGC
+ERR1719154.3.1 H10C:D1D8LACXX:2:1101:1411:2137 length=99
=DDDFFFHGHHIIGHGIIJIJJJIIJIIJGIGIIIIJFGHGGGIEHIIIJFIJGIIIIJJIIJJJIJEHFFDCCDDDDDDDDACDDDDDDDDDEDDDD8
@H10C:D1D8LACXX:2:1101:1332:2138_F/1
AAATATCTCGTTCAACCTAATTATTATCCTCGTTGTTTGACTGCTTTGGTTAGATTAGTTAGTAGCATACCATTGCAATAGCCGAATGGATAAAACCTT
+ERR1719154.4.1 H10C:D1D8LACXX:2:1101:1332:2138 length=99
BDFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJIJJHIJIHIJJJIJJIJHGFIBCHIJHHGIGGIIGGIHDHHCHHGGHFFFFFDDDDDCCDDDDDBDD

[h.mon]

I think the sequence header is fine, but the quality header may cause trouble. How did you download / manipulate the files? I don't know if this is the cause of the error, but the quality header line (+ERR1719154.1.1 H10C:D1D8LACXX:2:1101:1390:2131 length=92) is different from the sequence header line (@H10C:D1D8LACXX:2:1101:1390:2131_F/1).