Converting .bowtie files to .sam

0

Entering edit mode

6.3 years ago

mmitra ▴ 60

Hi all, I have a couple of .bowtie alignment files and I would like to convert them to .sam. Can anyone please suggest a way to do that? Thanks in advance!

ChIP-Seq sequencing alignment bowtie sam • 2.2k views

ADD COMMENT • link 6.3 years ago by mmitra ▴ 60

0

Entering edit mode

There is no formal format called .bowtie. Are you sure these are not already in .sam format? What does file yourfile.bowtie show? Are you able see anything by head yourfile.bowtie?

ADD REPLY • link 6.3 years ago by GenoMax 148k

0

Entering edit mode

OP probably means the default output of bowtie before it switched to SAM. There is this legacy script from an ancient samtools version that you can have a look at.

ADD REPLY • link 6.3 years ago by ATpoint 86k

0

Entering edit mode

Yes, it seems to be the default output of bowtie. I will check the legacy script.

ADD REPLY • link 6.3 years ago by mmitra ▴ 60

0

Entering edit mode

When I used the file command, I got "ASCII text". Here are first two lines of the file (used head command):

K00208:8:1101:273.14:91.19#0/1  -   chr3    185872452   CTTACATCCTAAAGAAAAAAAAGTAAATGTAAGACAACATAATAAAAGTTA L[e[LLVLL`VLV[LL[VL`Lii``e`e[Leii`Le`eeieiieieV[[LL 0   43:T>C

K00208:8:1101:281.26:91.19#0/1  +   chr15   76280494    CCCACATAGACGACTGATATAGCATGCTAATTGATCTCCCCATTACTATAC `[`ee[eeL[`L`VLVeie`[[LLLLHV[iVeL`L[LLLHHVLVL`LLLVL 0   5:C>A,23:C>A

ADD REPLY • link updated 6.3 years ago by GenoMax 148k • written 6.3 years ago by mmitra ▴ 60

Login before adding your answer.