EMBOSS transeq translate to protein with 3 letter code

Question

[marongiu.luigi]

dear all,

would be possible to translate a nucleotide sequence with the three letter code using EMBOSS transeq? I can do it with the one letter code

$ echo atgtttcaggacccacaggagtaa | transeq -filter -osformat2 text
MFQDPQE*

But I don't see in the manual the 3 letter code.

Thank you

[GenoMax]

If you don't see that option in the manual then no. You could do some replacements with sed if you must have three letter code.

[lieven.sterck]

Any particular reason why you want to do that? It will only be very confusing ...

[marongiu.luigi]

Just for graphical reasons: with the three letter code, it is easier to see the correspondence with the triplette:

atgttt...
MetPhe...

[h.mon]

I find this even easier:

atgttt
 M  F

[marongiu.luigi]

yes but you need to add 5 spaces because the sequence is given as MF not ad _M__F_

[h.mon]

Not quite right, the general pattern is you have to insert one initial space, then two spaces between every amino acid, then a final space. There are several tricks around to split a string into characters. As I like perl, split //, $_ would split a string at every character, then join with join. The split PerlDoc has some examples of using them together.

[WouterDeCoster]

It wouldn't be too hard to write a script which converts between one and three letter codes. There must be ample python examples to get you started.

[marongiu.luigi]

sure, that is not the problem, just wanted to know if transeq does it directly to save the effort...

Answer 1

[cpad0112]

The output peptide sequence is always in the standard one-letter IUPAC code.

http://structure.usc.edu/emboss/transeq.html

and try this:

$ echo atgtttcaggacccacaggagtaa | showseq -filter -threeletter y -format 4

           10        20        
  ----:----|----:----|----
  atgtttcaggacccacaggagtaa

  MetPheGlnAspProGlnGlu***

[marongiu.luigi]

that is exactly what I have been looking for! thank you

[WouterDeCoster]

I have moved the comment of cpad0112 to an answer so it can be accepted.