conversion binary to ATGC

Question

[bulbul]

CloneID                  Sequence                               CloneID P1  P2  1   2   3   4
11061   TCGCTGTACACTGTTGACGTCGCC        11061   1   1   1   1   1   1
11294   AAAGGTTCTATCTCGCTGAAACCCAG  11294   0   1   1   1   1   1
22912   ACCATCGCTGCACCACCTTGACCT             22912  1   -   1   1   1   1
11324   AGCAGCGTCGACTGCCGAGATCGG            11324   1   1   1   1   1   1
10918   GACGTGGCCGAGATCGGAAGAGC         10918   -   1   1   1   1   1
22617   AGCAGCGGTGTGTCACCATGGGGTG   22617   0   1   1   1   -   1
30239   TACCTCCGAGATCGGAAGAGCGGTTCG 30239   -   1   1   1   1   1
18650   GACTTGCCTGCGCGCCGCC                 18650   1   1   1   1   1   1
10995   TGAAATGCCGTGCATGATTAA               10995   1   1   1   -   1   1
11261   TAGGTTACCTTCCGAGATCGGAAG           11261    1   1   1   1   1   1

This is my DArT example data (it's already in biallelic format). How Should i convert into AT, GC format for each binary digit? Kindly help me. Thanks in advance.

[GenoMax]

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time.

Thank you!

[sangram_keshari]

Hi, Can you please clearly mention which binary digit data belongs to which nucleotide?

[bulbul]

"0" = Reference allele homozygote, "1"= SNP allele homozygote, "-" = missing. But I do not know to to convert the above example data into AT GC AA CC like. kindly suggest me. thank you.

[h.mon]

This format is the output from which program? Aren't there any accompanying input / output files? How did you obtain this output?

With the information you provided, it is impossible to help in any way.

[lakhujanivijay]

I have done it for you this time. However, please follow what genomax told in his comment from next time onwards