error in mapper script in miRDeep2
0
0
Entering edit mode
6.1 years ago

Hi all

I'm used the following mapper script for miRNA alignment in miRdeep2. I am getting error and also the reads_vs_genome.arf is empty. I am posting the error message herewith

    mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p /home/shanthi/Desktop/Nivya/indexed_genome/genome.fa -s collapsed_reads.fa -t collapsed_reads_vs_genome.arf -v -n -h
    parsing fastq to fasta format
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
usage: /home/shanthi/miniconda2/bin/convert_bowtie_output.pl reads_mapped.bwt
trimming unmapped nts in the 3' ends
Log file for this run is in mapper_logs and called mapper.log_28941
Mapping statistics


    #desc   total   mapped  unmapped    %mapped %unmapped
Use of uninitialized value $count2 in subtraction (-) at /home/shanthi/miniconda2/bin/mapper.pl line 708.
total: 2716769  Use of uninitialized value $count2 in print at /home/shanthi/miniconda2/bin/mapper.pl line 708.
    2716769 Use of uninitialized value $count2 in division (/) at /home/shanthi/miniconda2/bin/mapper.pl line 709.
Use of uninitialized value $count2 in division (/) at /home/shanthi/miniconda2/bin/mapper.pl line 709.
0.000   1.000
Use of uninitialized value in subtraction (-) at /home/shanthi/miniconda2/bin/mapper.pl line 711.
seq: 2716769    Use of uninitialized value in print at /home/shanthi/miniconda2/bin/mapper.pl line 711.
    2716769 Use of uninitialized value in division (/) at /home/shanthi/miniconda2/bin/mapper.pl line 712.
Use of uninitialized value in division (/) at /home/shanthi/miniconda2/bin/mapper.pl line 712.
0.000   1.000

Could somebody help me??

Thank You in advance

mapper module mirdeep2 • 1.2k views
ADD COMMENT

Login before adding your answer.

Traffic: 1649 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6