standalone blast output to excel

Question

[shuksi1984]

I want the standalone blast output in a specific format, which needs to have only aligned sequence the corresponding sequence id . Hence, is it possible to dump standalone blast output to excel?

[5heikki]

Yes, just use -outfmt 6 or -outfmt 10 for tab or comma separated values and import to excel accordingly. You also need to define the output fields you're interested in. You can see all options with blastn -help

[Chirag Parsania]

which needs to have only aligned sequence the corresponding sequence id.

Could you please explain more ?

[shuksi1984]

Following should be the content of excel:

Score   Expect  Identities  Gaps    Strand
6.684e+06 bits(3619559)     0.0     3619559/3619559(100%)   0/3619559(0%)   Plus/Plus

Query  1       
TACCATTTGAGTATTTCTGAATTTAGGTATTTATTTTCGCGTTCGTATAGAAATACTCCA  60
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct  1 
TACCATTTGAGTATTTCTGAATTTAGGTATTTATTTTCGCGTTCGTATAGAAATACTCCA  60

[lieven.sterck]

you can indeed (as 5heikki says) get this from the tabular blast output. It might/will require some reformatting though as you will get all on a single line from blast