Adaptor trimming for RNAseq

Question

[MAPK]

I have a few samples of RNA-seq data. I have this adaptor sequience (AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG (NNNNNN= 6 nt index)). Can someone please tell me what NNNNNNN =6 index indicates here? I was using BBMap tools to do the trimming and created the adaptor file like below, but I do not see any change in my new trimmed file (in terms of file size).

>adaptor1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG

[lieven.sterck]

firstly, file size is not always the best indicator of success or failure ;-) .

where did you get that adaptor sequence from? Did the seq facility provide that to you? I think they simply want to indicate there is a 6nt index present at the location of the Ns

[MAPK]

Yes, it was provided by the sequencing facility.

[lieven.sterck]

and they did not provide any additional information, eg. what the index might be then?

long shot, but might they be present in the read headers in the fastq file?

[MAPK]

No, they did not provide anymore information, except for that adaptor sequence. The fastq header only has this info:

@K00317:102:HKVG3BBXX:4:1101:15889:1349 1:N:0:TGGTGAAG+TGGTGAAG
GTAGACTTGATAGTGATACCACGCTCTTGTTCAACGGCACGAGTATCGGGAGCTCTGGCATCACCAGCCTTTGCGGCGGA
+
AAFFFJJJ7FJFJJFJAJ<JJJJJFJJJJ<JJF-FFJJJJ-<JJJ7JJJ7FA<-A7FJJJFJJJAJAAJFAJ7AA7--<F
@K00317:102:HKVG3BBXX:4:1101:16295:1349 1:N:0:TGGTGAAG+TGGTGAAG
GGACAGGTCTGGCTCGGTTTTTGATATCTTCAGTTTAAGGGGGCGAATATCGTTACCCATAGATACCGAAAGTGGCCGAC
+

[GenoMax]

What does the summary stats say about the trimming? Perhaps there are no adapters (always theoretically possible) or you were given an incorrect adapter sequence (also possible).

Answer 1

[GenoMax]

I would not worry about what NNNNN is, if the core sequence you are trying to remove is common. Use literal=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ktrim=r to get all variations of NNNNN.

[MAPK]

Thanks for your answer. So just to be clear, should I just have

>adaptor1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

and omit NNNNNNATCTCGTATGCCGTCTTCTGCTTG?

[GenoMax]

Sure. As long as the leading sequence is identical for all adapters.

[lieven.sterck]

or the trailing? [confused myself here]

[GenoMax]

Once the first part is identified one generally wants to remove everything till the end on right so the trailing part gets automatically included.

[lieven.sterck]

ok, so that was my confusion: the right side is the end thus (== not next to the actual sequence?)