mirDeep2 mapping error

Question

[nivya.james2016]

Hi all,

Kindly help me with this issue

shanthi@shanthi-client2:~/Desktop/Nivya/Fastq files/SRR7189567-stage 1A$ mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p genome -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h
parsing fastq to fasta format
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
Could not locate a Bowtie index corresponding to basename "genome"
Please make sure you used bowtie version 1 to build the index.
Usual index files have suffix .ebwt

I have used bowtie version 1. But i dont know why this is occuring.

Thank You in advance

[Bastien Hervé]

Please add the command you used to generate the genome index with bowtie 1

Could not locate a Bowtie index corresponding to basename "genome"

[nivya.james2016]

i used the command to generate bowtie files

bowtie-build genome.fa genome

[Bastien Hervé]

Do you have a directory called genome with .ebwt files inside ?

Could you copy paste the log file of the bowtie-build command please

[nivya.james2016]

yes i do have genome directory with .ebwt files.. but there are no log files other than .ebwt files inside. but after doing the mapper.pl function there is a bowtie log file. Kindly check these files

Could not locate a Bowtie index corresponding to basename "genome"
Command: bowtie -p 1 -f -n 0 -e 80 -l 18 -a -m 5 --best --strata --al dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/trim_3_SRR7189567.fastq_mapped --un dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/trim_3_SRR7189567.fastq_not_mapped genome dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/reads_nr.fa dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/mappings.bwt

[Tm]

Please make sure the index name which you have provided during bowtie-build is same as what you are providing after '-p' option.

[nivya.james2016]

Yes. i checked again. It is the same index name that i have provided after -p option.

Answer 1

[Bastien Hervé]

Is the genome index directory in your current path (~/) ? Otherwise you should had the absolut path of the genome index directory in your command line.

[nivya.james2016]

Ok. I shall check it. Thank you so much.

[nivya.james2016]

Thank You so much Bastein i was able to get the results when done like you suggested.