I am using a FASTA file with many sequences that I wish to filter. An example of the file is as follows:
>SRR5533383:0::12:0:0:0:
GTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACTATTAAGTCAGCTGAGAAAGTTTGCGGCTCAACCGTAAAATTG$
>SRR5533383:0::19:0:0:0:
GTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGATTTATTAGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTG$
>SRR5533383:0::17:0:0:0:
GTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACATGTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTG$
Where the line that starts with ">" is the header and the line below it is a sequence. For each sequence there is a header. I want to be able to filter the sequence based on a minimum length (150 base pairs) that they must have in order to be kept in the main file. If the sequence is < 150 then I want it to be removed from the main file and the header of the removed sequence should go to another file ("bad reads file") where the reason it was excluded is included. Such that the output of the "bad reads" file looks like:
>SRR5533383:0::17:0:0:0:
"Excluded because too short"
I'm trying to use the following code to filter the sequences but I can't get it to work:
sequences = {}
with open("seq.fasta") as file:
header = None
data = ''
for line in file:
if line.startswith(">"):
if header and data:
sequences[header] = data
data = ''
header = line.rstrip()
else:
data += line.rstrip()
if header and data:
sequences[header] = data # deal with the last one in the file
for header, data in sequences.items():
print("{}; {}".format(header, data))
#Creates "sequences" in header:sequences
seq = np.asarray(list(data))
print(seq)
#Minimum threshold
min_length = 150
for line in data:
if line >= min_length:
print("Sequences meeting the minimum threshold are kept in paired.fasta")
else:
data.removeline with open("output.log", "w")
print("%i removed because too short" % (header))
Thank you so much! This is exactly what I was looking for. I'm still new to python and practicing :)
Just a question, if I wanted to edit the seq.fasta file such that only the good reads remained in it, is that possible? In your solution there is a new good_reads.fasta which works perfectly but if I wanted to continue to use seq.fasta with just the good reads in it could I do that? Could it be possible to overwrite the seq.fasta file like this:
Yes, this would work, however it's generally bad practice because doing this will destroy your input file.
It would be best to save your output as a new file in case something goes wrong in your program and your output isn't what you'd expect. For example, imagine in the codeblock you posted there that you accidentally wrote
for header in bad_reads
. If you ran this it will overwrite your input file with only the bad reads - this is obviously an easy fix in the python program to change it togood_reads
, except that you no longer have any good reads in your seq.fasta file because you overwrote it.At the very least, if you want the output name to be identical, you should make a new directory and output the filtered file there:
with open("outputs/seq.fasta", "w+") as good_out: